How does fecundation occur in angiosperms, Biology

Assignment Help:

After the pollination how does fecundation occur in angiosperms? In these plants is fecundation dependent on water?

After the pollination one of the sperm nuclei from the pollen tube unites with the oosphere of the embryonic sac forming the diploid (2n) zygote. The erstwhile sperm nucleus fuses with the polar nuclei of the embryonic sac originating a triploid (3n) cell that by mitosis will turn into the secondary endosperm of the seed. The synergids as well as the antipodal cells degenerate after the fecundation process.

Fecundation in the plants is independent from water.

 


Related Discussions:- How does fecundation occur in angiosperms

Difference between tracheophytes and bryophytes, Q. What is the difference ...

Q. What is the difference between tracheophytes and bryophytes? Bryophytes are nonvascular plants (liverworts, mosses, hornworts), that is they do not have a conductive system

Determine the osseointegration, What is osseointegration The smaller th...

What is osseointegration The smaller the devital zone that forms around the implant subsequent to the surgical trauma, the more likely rigid fixation will occur. The aim is to

Define absorption, Define Absorption, Storage and Elimination of Pyridoxine...

Define Absorption, Storage and Elimination of Pyridoxine? Pyridoxine, pyridoxal and pyridoxamine (along with their phosphorylated forms) occur in plant and animal foods. The ph

Define isolated soybean proteins in meat product, Define Applications of Is...

Define Applications of Isolated Soybean Proteins in Meat products? The major application of ISP in connection with meat and related products is based on the use of texturized I

Deficency diseases and metabolic disorders, Deficency Diseases and Metaboli...

Deficency Diseases and Metabolic Disorders Nutrients required for life sustenance are grouped into 6 basic classes, viz. water, carbohydrates, proteins, fats, minerals and vita

Formation of double bonds, In eukaryotes  the SER has enzymes  able to begi...

In eukaryotes  the SER has enzymes  able to begin  double  bonds into fatty acyl CoA molecules  in an oxidation  reaction  which uses molecular  oxygen.  This reaction is catalyzed

Determine the axon of a nerve cell, In the axon of a nerve cell, A. the...

In the axon of a nerve cell, A. the voltage-dependent conductance of the voltage-gated potassium channel has a faster time course than the voltage-dependent conductance of the

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Treatment of diarrhoea, Treatment   Most cases of diarrhoea do not need...

Treatment   Most cases of diarrhoea do not need antibiotic therapy as the bacterial or parasitic organism are not isolated from most of the cases. However chemotherapeutics  ar

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd