Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
After the pollination how does fecundation occur in angiosperms? In these plants is fecundation dependent on water?
After the pollination one of the sperm nuclei from the pollen tube unites with the oosphere of the embryonic sac forming the diploid (2n) zygote. The erstwhile sperm nucleus fuses with the polar nuclei of the embryonic sac originating a triploid (3n) cell that by mitosis will turn into the secondary endosperm of the seed. The synergids as well as the antipodal cells degenerate after the fecundation process.
Fecundation in the plants is independent from water.
Q. What is the difference between tracheophytes and bryophytes? Bryophytes are nonvascular plants (liverworts, mosses, hornworts), that is they do not have a conductive system
What is osseointegration The smaller the devital zone that forms around the implant subsequent to the surgical trauma, the more likely rigid fixation will occur. The aim is to
Define Absorption, Storage and Elimination of Pyridoxine? Pyridoxine, pyridoxal and pyridoxamine (along with their phosphorylated forms) occur in plant and animal foods. The ph
protozoa locomotion
Define Applications of Isolated Soybean Proteins in Meat products? The major application of ISP in connection with meat and related products is based on the use of texturized I
Deficency Diseases and Metabolic Disorders Nutrients required for life sustenance are grouped into 6 basic classes, viz. water, carbohydrates, proteins, fats, minerals and vita
In eukaryotes the SER has enzymes able to begin double bonds into fatty acyl CoA molecules in an oxidation reaction which uses molecular oxygen. This reaction is catalyzed
In the axon of a nerve cell, A. the voltage-dependent conductance of the voltage-gated potassium channel has a faster time course than the voltage-dependent conductance of the
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Treatment Most cases of diarrhoea do not need antibiotic therapy as the bacterial or parasitic organism are not isolated from most of the cases. However chemotherapeutics ar
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd