Etiological factors contributing to lactose intolerance, Biology

Assignment Help:

Q. Etiological factors contributing to lactose intolerance?

The etiological factors contributing to lactose intolerance include:

• Genetic factor

• Reduction in jejunal lactase activity due to infections in the gut.

• Any structural damage to the jejunal mucosa in disease conditions like celiac, tropical sprue, colitis in which the jejunal vili are structurally damaged.

• Surgical causes '.in which large part of jejunum is removed.


Related Discussions:- Etiological factors contributing to lactose intolerance

Camptotheca acuminata, This species is an ornamental tree in China, and has...

This species is an ornamental tree in China, and has yielded the clinically active agents topotecan, irinotecan, and 9 -aminocamptothecin, which are semisynthetically derived from

Explain about the gel bands detection techniques, Explain about the Gel ban...

Explain about the Gel bands detection techniques? Gel bands, resulting from a gel electrophoretic separation, may be detected by staining, radioactive counting or immunoblottin

Spermatogonia - spermatozoa, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4 Spermatogonia - Spe

Desscribe formation of sperm cells from germ cells, Q. Indicating the name ...

Q. Indicating the name and respective ploidy of each involved cell how can the formation of sperm cells from germ cells be described? The formation of spermatogenesis or sperm

Difference between cryptogamic and phanerogamic plants, What is the differe...

What is the difference among cryptogamic and phanerogamic plants? Cryptogamic (hidden sex organs) plants are those that do not show flowers or seeds. They comprise the bryophy

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain metabolism of iron, Explain Metabolism of Iron? In this sub-sec...

Explain Metabolism of Iron? In this sub-section, we will study how body gets its iron supply, how iron is transported and utilized by the various tissues and how iron balance i

Explain the width of the periimplant keratinized mucosa, Width of the Perii...

Width of the Periimplant keratinized Mucosa Clinical and experimental studies have failed to support the concept of an "adequate width" of keratinized tissue adjacent to natura

Determine the carbon based materials, Carbon Based Materials These incl...

Carbon Based Materials These include Pyrolytic carbon, polycrystalline (Vitreous Carbon), and carbon/silicon interstitial combination. Vitreous Carbon -Solid or porous vitre

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd