Define osseointegration from diffrent points of view, Biology

Assignment Help:

Q. Define Osseointegration from patients, microscopic and biomechanical points of view.

a) From the view of the patient.

An implant fixture is osseointegrated if it provides a stable and apparently immobile support of a prosthesis under functional loads, without pain, inflammation or loosening over the lifetime of the patient.

b)  From a view point of macro and microscopic biology and medicine.

Osseointegration of a fixture in bone is defined as the loose apposition of new and reformed bone in congruence with the fixture, including surface irregularities, so that at light microscopic level, there is no interpositioned connective or fibrous tissue and that a direct structural and functional connection is established, capable of carrying normal physiological loads without excessive deformation and without initiating rejecting mechanism.

c) From a macroscopic biomechanical point of view.

A fixture is osseointegrated if there is no progressive relative motion between the fixture and surrounding living bone and marrow under functional levels and types of loading for the entire life of the patient and exhibits deformation of the same order of magnitudes as when the same loads are applied directly to the bone.

d) From a microscopic biophysical point of view

Osseointegration implies that at light microscopic and electron microscopic levels, the identifiable components of tissue within a zone of a fixture surface are identified as normal bone marrow constituents which continuously grade into a normal bone structure surrounding the fixture: that mineralized tissue is found to be in contact with fixture surface over most of the surface within nanometers.


Related Discussions:- Define osseointegration from diffrent points of view

Orthopedics, 1. List alternative therapies for musculoskeletal problems. ...

1. List alternative therapies for musculoskeletal problems. 2. What is a xyrospasm? What is the Greek derivative of the word? 3. Name and describe the three types of varus con

Photosynthesis, why we add some sodium bicarbonate in water?

why we add some sodium bicarbonate in water?

Management for poisoning and overdose, Management  for Poisoning  and Ove...

Management  for Poisoning  and Overdose: The following data should be obtained at the time of initial contact.  Phone Number:  getting the caller's telephone number  is n

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Protoplasmic theory, Protoplasmic Theory The living matter which forms ...

Protoplasmic Theory The living matter which forms the bodies of all living being is a special type of highly organized jelly like viscous semi fluid, and named Sarcode by Dujar

Define energy requirements and dietary energy recommendation, Define Energy...

Define Energy Requirements and Dietary Energy Recommendations? Energy requirement, as you may recall studying earlier, is the amount of food energy needed to balance energy exp

Urinary system, Structures that l pyramidenaform the r

Structures that l pyramidenaform the r

Experiment to test your hypothesis, Deinococcus radiodurans is a bacterium ...

Deinococcus radiodurans is a bacterium that was isolated from cooling ponds in and around nuclear power plants. It is highly resistant to ionizing radiation. Propose an hypothesis

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd