Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the pH Meter - Food Microbiology?
pH is a negative logarithm of H+ ion concentration. Its value remains between 0 and 14. Pure water has a pH of 7 (neutral). pH value less than 7 is acidic and more than 7 is basic. The measurement of pH can be done by using pH meter. pH meter is used to measure and set the pH of culture media or reagents used for microbiological and biochemical assays. It is important as different microbes have different pH requirements for growth. Most of the bacteria, in general, have optimum pH for growth between 6.5 to 7.5, though there are certain exceptions.
Some bacteria are acidophiles (grow at acidic pH) or alkalophiles (needs high pH in alkaline range for growth). Most fungi have pH optima around 4 to 6 and yeasts need pH around 3 to 5. The pH meter has a glass electrode for measuring the pH. During determination of pH, first the instrument is calibrated with standard buffers of pH 4, 7 and 9. Then the pH of the sample solution is determined by dipping the glass electrode in the solution and pH is read directly from the pH meter scale.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
This is a broadly used screening technique that find several genomic mutations in wide number of samples, this technique finds sequence variations because of point mutations or oth
Central Nervous System Hypertension is one of the leading causes of cerebrovascular disease. It has been associated with accelerated age related cognitive decline. The most d
Q. What is thyroid disease? Thyroid disease: Thyroid disease is associated with angina. Anginas pectoris presents itself in the form of speific symptoms which tend to re- oc
A plant grown from one of Mendel's yellow peas is selfed. Five progeny peas are obtained from this self and they are all yellow. If the original selfed plant had been homozygous, w
Q. List the major chemical changes occurring in food? The major chemical changes occurring in food are lipid oxidation leading to rancidity, loss of vitamins and degradation
Nitrate Uptake Nitrate must enter the cells before undergoing assimilatory reduction by the joint action of nitrate reductase and nitrite reductase. Cells accumulate NO - 3
Define Vitamin and mineral supplements for treatment for PEM? All cases of severe PEM require multivitamin preparation to meet the increased demands during recovery. Iron (60 m
WHAT TRAITS ALLOWED VASCULAR PLANTS TO GROW TALL
What is karyotype? The name karyotype is given to the set of chromosomes of an individual, generally when visualized and identified under the microscope. The visualization usua
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd