Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the pH Meter - Food Microbiology?
pH is a negative logarithm of H+ ion concentration. Its value remains between 0 and 14. Pure water has a pH of 7 (neutral). pH value less than 7 is acidic and more than 7 is basic. The measurement of pH can be done by using pH meter. pH meter is used to measure and set the pH of culture media or reagents used for microbiological and biochemical assays. It is important as different microbes have different pH requirements for growth. Most of the bacteria, in general, have optimum pH for growth between 6.5 to 7.5, though there are certain exceptions.
Some bacteria are acidophiles (grow at acidic pH) or alkalophiles (needs high pH in alkaline range for growth). Most fungi have pH optima around 4 to 6 and yeasts need pH around 3 to 5. The pH meter has a glass electrode for measuring the pH. During determination of pH, first the instrument is calibrated with standard buffers of pH 4, 7 and 9. Then the pH of the sample solution is determined by dipping the glass electrode in the solution and pH is read directly from the pH meter scale.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is the commercial importance of algae? Numerous algae have high nutritional value and are commercialized and consumed as human food they are very popular food in the or
wrt spoilage
Q. What is the gas exchange unit of the mammalian lungs? The gas exchange units of the mammalian lungs are the alveoli. Q. What is the physical process through which gas ex
LYMPH - Lymph is a mobile connective tissue comprising lymph plasma (fluid) and lymphcorpuscles (cells). COMPOSITIO N - (i ) Lymph Plasma - It is simil
Q. What is the ecological role of earthworms? Earthworms have an important ecological role as they eat decomposing organic material. They also dig tunnels in the subsoil allowi
Define the Importance of Human Milk for Infant Growth and Development? Let us now look at the value of human milk in promoting infant growth and development. Success of lactat
Elaborates the Pathophysiology of ventricular septal defect? The shunt in the VSD is left to right. The magnitude of the shunt is determined by the size of the VSD and the, lev
Q. How does digestion in beings of the phylum Annelida work and which type of digestive system do they have? Digestion in beings of the phylum Annelida is extracellular. These
What are the principal sources of of excessive nitrate and phosphatebin rivers and lakes?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd