Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the pH Meter - Food Microbiology?
pH is a negative logarithm of H+ ion concentration. Its value remains between 0 and 14. Pure water has a pH of 7 (neutral). pH value less than 7 is acidic and more than 7 is basic. The measurement of pH can be done by using pH meter. pH meter is used to measure and set the pH of culture media or reagents used for microbiological and biochemical assays. It is important as different microbes have different pH requirements for growth. Most of the bacteria, in general, have optimum pH for growth between 6.5 to 7.5, though there are certain exceptions.
Some bacteria are acidophiles (grow at acidic pH) or alkalophiles (needs high pH in alkaline range for growth). Most fungi have pH optima around 4 to 6 and yeasts need pH around 3 to 5. The pH meter has a glass electrode for measuring the pH. During determination of pH, first the instrument is calibrated with standard buffers of pH 4, 7 and 9. Then the pH of the sample solution is determined by dipping the glass electrode in the solution and pH is read directly from the pH meter scale.
Slow walking or Crawling This type of locomotion is seen while the animal moves on the substratum. It involves a metachronal rhythm of action in the parapodia. Each fifth or
what are the excretory organs of birds
ABSORPTIO N OF FOOD Absorption from Mouth Here negligible tobacco, alkohal and some medicines as isoprenailne glycerol tri nitrite is absorbed. Absorptio n from Sto
In which period of life does the formation of gametes begin in women? The meiosis that forms female gametes begins in the cells of the ovarian follicles before birth. After the
what is biological sickness of soil and its management
Study of tonana larva Tornaria larva is typical in the life-history of hemichordates. Examine the permanent slide and note the following features: I. The tornaria larva usu
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Which are the groups of living beings that form the protist kingdom? The protist kingdom contains protozoans and algae. (Two groups of fungi with same characteristics to protoz
how conjugation takes place in paramecium
Nongonococcal nonchlamydial urethritis and cervicitis Nongonococcal urethritis (NGU) in men is often nonchlamydial as well. Possibly caused by Ureaplasma urealyticum, Mycoplas
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd