Explain the ph meter - food microbiology, Biology

Assignment Help:

Explain the pH Meter - Food Microbiology?

pH is a negative logarithm of H+ ion concentration. Its value remains between 0 and 14. Pure water has a pH of 7 (neutral). pH value less than 7 is acidic and more than 7 is basic. The measurement of pH can be done by using pH meter. pH meter is used to measure and set the pH of culture media or reagents used for microbiological and biochemical assays. It is important as different microbes have different pH requirements for growth. Most of the bacteria, in general, have optimum pH for growth between 6.5 to 7.5, though there are certain exceptions.

Some bacteria are acidophiles (grow at acidic pH) or alkalophiles (needs high pH in alkaline range for growth). Most fungi have pH optima around 4 to 6 and yeasts need pH around 3 to 5. The pH meter has a glass electrode for measuring the pH. During determination of pH, first the instrument is calibrated with standard buffers of pH 4, 7 and 9. Then the pH of the sample solution is determined by dipping the glass electrode in the solution and pH is read directly from the pH meter scale.


Related Discussions:- Explain the ph meter - food microbiology

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Single stranded conformation polymorphism analysis, This is a broadly used ...

This is a broadly used screening technique that find several genomic mutations in wide number of samples, this technique finds sequence variations because of point mutations or oth

Target organ damage, Central Nervous System   Hypertension is one of th...

Central Nervous System   Hypertension is one of the leading causes of cerebrovascular disease. It has been associated with accelerated age related cognitive decline. The most d

What is thyroid disease, Q. What is thyroid disease? Thyroid disease: T...

Q. What is thyroid disease? Thyroid disease: Thyroid disease is associated with angina. Anginas pectoris presents itself in the form of speific symptoms which tend to re- oc

What would be the probability of obtaining result, A plant grown from one o...

A plant grown from one of Mendel's yellow peas is selfed. Five progeny peas are obtained from this self and they are all yellow. If the original selfed plant had been homozygous, w

List the major chemical changes occurring in food, Q. List the major chemic...

Q. List the major chemical changes occurring in food? The major chemical changes occurring in food are lipid oxidation leading to rancidity, loss of vitamins and degradation

Nitrate uptake, Nitrate Uptake Nitrate must enter the cells before und...

Nitrate Uptake Nitrate must enter the cells before undergoing assimilatory reduction by the joint action of nitrate reductase and nitrite reductase. Cells accumulate NO - 3

Define vitamin and mineral supplements for treatment for pem, Define Vitami...

Define Vitamin and mineral supplements for treatment for PEM? All cases of severe PEM require multivitamin preparation to meet the increased demands during recovery. Iron (60 m

VASCULAR PLANTS., WHAT TRAITS ALLOWED VASCULAR PLANTS TO GROW TALL

WHAT TRAITS ALLOWED VASCULAR PLANTS TO GROW TALL

What is karyotype, What is karyotype? The name karyotype is given to th...

What is karyotype? The name karyotype is given to the set of chromosomes of an individual, generally when visualized and identified under the microscope. The visualization usua

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd