Uterine torsion, Biology

Assignment Help:

Uterine Torsion


Incidences of uterine torsions in cattle and buffaloes are not common. However, they are very common in heavy breeds and buffaloes and animals in slopy terrain. In Bos indicus cattle the ventral attachment of broad ligament changes from ventral at the body to the dorsal at the tip of the horns. In advanced stage of pregnancy in pluriparous cow broad ligament is looser and longerWhen the cows get up on their hind legs, the strong foetal movements together with an empty stomach and poor muscle tone leads to uterine torsion. The animals show abdominal pain and discomfort due to stretching of broad ligament. Other signs such as anorexia, rumen stasis, constipation, increased pulse and respiration are usually present. The 34% of the uterine torsion occurs anterior to the cervix. The 45 to 900  torsions are uncommon. The prognosis depends on the degree of severity and largely on the extent of vascular involvement.


Related Discussions:- Uterine torsion

Determine the occurrence of biotin, Occurrence of Biotin Biotin occurs ...

Occurrence of Biotin Biotin occurs in nature very likely in all living cells, although usually in minute concentrations. In animal organs and in yeast, biotin is mainly cont

What are the ions, Q. What are the ions? What are the two kinds of molecule...

Q. What are the ions? What are the two kinds of molecules into which ions are classified ? Ions are substances or atoms electrically charged by means of gain or loss of electron

Why did scientists want to map the human genome, Why did scientists want to...

Why did scientists want to map the human genome? They wanted to learn the location of all the significant genes in the genome in order to learn how the genome is organized, ho

What are the typical features of mammals, Q What are the typical features o...

Q What are the typical features of mammals? The typical features of mammals are: body (less or more) covered with hair; presence of the diaphragm muscle that separates the thor

Give the genotypes, Achondroplasia is an autosomal dominant disorder associ...

Achondroplasia is an autosomal dominant disorder associated with a gene on chromosome 4. Sickle cell anemia is due to a gene on chromosome 11. A man and a woman with achondroplasia

Measure to be taken in the event of tsunami, ·          If we are in danger...

·          If we are in dangerous areas, water, gas and electricity should be turned off quickly and we should move to a higher level of ground.                  ·          It s

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Name the material used in bioinert, Bioinert Metals:-  Commercially pur...

Bioinert Metals:-  Commercially pure titanium/ titanium alloys Ceramics:-  Aluminum oxide, zirconium oxide

Phylum protozoa, classification of organisms in phylum protozoa according t...

classification of organisms in phylum protozoa according to their class,order,family,genus,species.

Explain assessment of iron status - serum ferritin, Explain assessment of i...

Explain assessment of iron status - Serum Ferritin? Serum Ferritin: This method is indicative of iron stores. As we know, a long term negative iron balance first results in dep

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd