Synovial fluid and amniotic fluid collection, Biology

Assignment Help:

Synovial fluid Collection:

The technique of obtaining synovial fluid is called arthrocentesis. It is used to characterize type of arthritis and to differentiate inflammatory from non inflammatory effusions.

Sterile plain tubes are used for culture and for glucose and protein estimation; EDTA tube is used for a total leukocyte, differential, and erythrocyte count.

Amniotic fluid Collection:

The procedure is called amniocentesis and is done for prenatal diagnosis of congenital disorders, to assess fetal maturity, or to look for Rh isoimmunization or intrauterine infection.

Skin should be cleaned, and 10 mL of fluid is aspirated into a syringe. Glass containers are used to transport the fluid to the laboratory.

If the specimen is for determination of lecithin/sphingomyelin (L/S) ratio, the container is immediately placed in ice; if it is for spectrophotometric, the specimen should be transferred to a brown tube or bottle to prevent photodegradation of bilirubin.

 


Related Discussions:- Synovial fluid and amniotic fluid collection

Determine about the visual axes of eyes, Determine about the visual axes of...

Determine about the visual axes of eyes In normal eyes, the visual axes are parallel to each other in the primary position of gaze. This position is usually maintained but in t

Illustrate in detail about the cell theory, Illustrate in detail about the ...

Illustrate in detail about the Cell theory All living organisms are composed of cells, and they are the basic structural and functional units of life, just like the atom is a

Explain about carrier proteins transport substances, How do carrier protein...

How do carrier proteins transport substances across cell membranes? Carrier proteins bind to a molecule of the substance on single side of the membrane, change shape, transpor

Explain the function of muscular tissue, How can the presence, localization...

How can the presence, localization and function of muscular tissue in beings of the phylum Annelida be explained? In these beings there are a longitudinal muscular layer under

External factor - factor controlling metamorphosis in insect, External fact...

External factors - Factors Controlling Metamorphosis in Insects In few cases an external factor may be accountable for initiating moulting, as for instance in the blood su

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Mode of nutition, What is the mode of nutrition of Ascaris?

What is the mode of nutrition of Ascaris?

Etiologic factor of congestive cardiac failure, Q. Etiologic factor of Cong...

Q. Etiologic factor of Congestive Cardiac Failure? Congestive heart failure develops over a period of time when the necrotic tissues are not replaced by functional connective c

Assessment of rheumatic fever, Assessment 1. Assess the past and prese...

Assessment 1. Assess the past and present history of illness, sore throat, rheumatic fever and treatment received previously.  2. Family history of rheumatic fever. 3. S

Pyruvate carboxylase activation, Oxaloacetate has two main roles. It is an ...

Oxaloacetate has two main roles. It is an intermediate which is consumed in gluconeogenesis and it is also a key intermediate in the citric acid cycle where it fuses with acetyl Co

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd