Explain precautions for estimation of reducing sugar, Biology

Assignment Help:

Explain Precautions for Estimation of Reducing Sugar by Fehling Soxhlet Method?

1. Clamp the burette so that the tip of the burette is exactly above the mouth of the conical flask.

2. Maintain continuous evolution of steam by continuous heating of the conical flask to prevent reoxidation of Cu⁺ ions.

3. Each titration should be completed within three minutes.

Related Discussions:- Explain precautions for estimation of reducing sugar

Cannulation-procedures of oxygenators, Cannulation : Typically blood is d...

Cannulation : Typically blood is drained by gravity through two cannulae inserted into the superior and inferior vena cavae. During bypass, if the SVC and IVC are snared, the ent

Ascitic fluid collection - specimen collection, Pleural, Pericardial, and A...

Pleural, Pericardial, and Ascitic fluid Collection: The procedure is called paracentesis . If for pleural cavity is called thoracocentesis , and for pericardial cavity c

What is fenugreek seeds, Q. What is Fenugreek seeds? Fenugreek seeds: '...

Q. What is Fenugreek seeds? Fenugreek seeds: 'Commonly known as methi seeds in Hindi. They are commonly used in Indian cuisine in chutney and even in pickles and several dishes

Lymph, Why lymph is also called middle man of body

Why lymph is also called middle man of body

Explain a reason these cells are used instead of outer body, The cells lini...

The cells lining the inside of the cheek are frequently removed for making observations of basic cell structure. The cells are from stratified squamous epithelium. Explain a reason

Carbohydrates, what is the structural formula for Galactose?

what is the structural formula for Galactose?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Nervous system of echinoderms, Nervous System of Echinoderms Previous ...

Nervous System of Echinoderms Previous to studying the nervous system of echinoderms, you have to bear in mind the peculiar organization of these animals. Here as well, the ne

Describe the the growth of the plants in the 2 groups, There has not been r...

There has not been rain for several months. A biologist is driving down the highway and notices that a large number of corn fields have corn that is wilted and short. She wonders i

Set up of phototherapy unit, Set Up of Phototherapy Unit Phototherapy ...

Set Up of Phototherapy Unit Phototherapy generally consists of four to eight cool white, day bright, or special blue fluroescent tube lights covered by a plastic shield and p

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages