Quantitative real-time pcr, Biology

Assignment Help:

1. You are given a pair of primers that has been shown amplify a 125 bp DNA of interest specifically by a end point PCR- as there was only one PCR product with a size of 125 bp detected by agarose gel electrophoresis.  How would you further develop this end-point PCR to be a quantitative real-time PCR?  Please provide a rationale for each step that you choose to further develop the assay and what is the alternative if your first choice is not working.

2.You have been asked to develop a monoclonal antibody against the human His-tagged Casc4 recombinant protein that you purified from the expression construct that you designed earlier in the semester (assume the protein is soluble).

a.) Outline a brief protocol for generating this monoclonal antibody using mice as the host species.

b.) What is a method for purifying this antibody from culture supernatant?

3. Zach wants to analyze the expression of transferrin receptor (a surface transmembrane protein) in an epithelial cell line with and without treatment using a certain drug.
a.) Outline a brief protocol for obtaining these results.
b.) Why did you choose this method?

 


Related Discussions:- Quantitative real-time pcr

Latitudinal variations, Latitudinal Variations The latitudinal variatio...

Latitudinal Variations The latitudinal variation of temperature over the earth is the result of two main variables incoming solar radiation and the distribution of lan

#nervous system, 6. What is the function of the myelin sheath? Do all axons...

6. What is the function of the myelin sheath? Do all axons present a myelin sheath?

Determine indicators used in monitoring and surveillance, Determine Indicat...

Determine Indicators used in monitoring and surveillance? Various simple indicators may be used such as: 1) Weight-for-height 2) Body mass index (weight in kg/square of h

What is the molarity of the solution, The molecular weight of "Y" is 200. I...

The molecular weight of "Y" is 200. I use 10g of "Y" in 10mL of water. What is the molarity of this solution of "Y"? What percentage solution of "Y" is it?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Solubility of gases in water, Solubility of Gases in water Most gases w...

Solubility of Gases in water Most gases which are important for biological processes dissolve readily and specially in water. The solubility of any gas in water generally var

Isonzerization of glucose-6-phosphate, Isonzerization of glucose-6-phosphat...

Isonzerization of glucose-6-phosphate Isonzerization  of  glucose-6-phosphate :  This step  is  catalyzed  by phosphoglucoisomerase to  form  fructose-6-phosphate.

Describe surgical treatment prosthetic valve endocarditis, Describe Surgica...

Describe Surgical Treatment prosthetic valve endocarditis ? If there is definite indication for early surgery, the current understanding is to proceed with valve replacement ir

Who did epa consult with outside of the agency, Who did EPA consult with ou...

Who did EPA consult with outside of the Agency in making this rule? EPA consulted with many agencies, organizations, and individuals in the process of finalizing the plant- inc

Ecosystems, what is biodiversity?where are ecosystems with the highest biov...

what is biodiversity?where are ecosystems with the highest bioversityfound?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd