Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
phylogenetic consideration
S-Gene The S-gene has been suggested to be a super gene complex with several linked genes. It is supposed to have at least six (may he more) closely-linked genes which determi
Glands A cell, tissue or organ which secretes specific chemical secretion is known as a gland. The glands develop from the epithelium tissues. The glands are classifi
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Evolutionary relationship among various animal groups is depicted in the cladogram given below. P, Q and R respectively shown: a. Vertebrae, hair and four limbs. b. B
Define about the Cellulose acetate electrophoresis (CAE)? If the hydroxyl groups in cellulose are reacted with acetic anhydride, cellulose is acetylated to form the raw materia
Q. Explain Spoilage of Poultry and Poultry Products? Poultry meat is the muscle tissue of chicken, ducks, turkey etc. The reference to poultry meat generally is the 'dressed ch
Define Factors related to Causing Malnutrition among CHD Patients? The various factors related to causing malnutrition among CHD patients are hypoxia (reduction in oxygen suppl
In most axons, myelin sheath is interrupted at intervals of about 1 millimeter or more. These interruptions are known as: a) Collaterals b) Nodes of Ranvier (pron: ron-vee-ay)
Cleavage - Metazoa The unicellular zygote begins cell division (cleavage). First, the single cell divides forming two cells, these redivide further to form four, then eight ce
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd