Reflex action, Biology

Assignment Help:

REFLEX ACTION -

  • Marshel Hall discovered reflex action. Best & Taylor defined it. Reflex action is functional unit of CNS.
  • It is sudden, immediate involuntary action against external stimuli. In man it is poly-synaptic.
  • If we prick needle on skin, somatic sensory nerves bring impulses to grey matter. Here these are analysed & order is given to muscle by motor nerve.
  • The path from which impulse is passed is reflex arch.
  • Minimum time is consumed in it. It is not under control of brain.

Some common reflex actions are -

1. Coughing

2. Yawning

3. Sneezing

4. Knee-jerk reflex

5. Bleenking of eyes

6. Scratch reflex

EXAMPLE -

1.       Cycling.

2.       Watering of mouth.

3.       Blinking of eyes in sharp light.

4.       Withdrawal of leg in pithed frog.

5.       Flow of bile from gall bladder.

6.       Peristalasis.

7.       Heart beat.

2243_reflex action.png

SIGNIFICANCE -

1. It enables animal to respond immediately to the harmful stimuli so that no harm is caused to it.

2. It gives more time to brain to work.


Related Discussions:- Reflex action

Hypnotic or anxiolytic intoxication and withdrawal, Barbiturate, Sedative, ...

Barbiturate, Sedative, Hypnotic or Anxiolytic Intoxication and Withdrawal: This Emergencies related  to  substance abuse may be acute  or chronic. The patient may come  to  th

Diversity2, using examples of invertebrate phyla illustrate how the increas...

using examples of invertebrate phyla illustrate how the increase in complexity is reflected by their nervous system?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Affect the rate of cellular respiration, how does temperature affect the ra...

how does temperature affect the rate of cellular respiration? please explain with great detail!

What are the signs used in acute pericarditis, Q. What are the Signs used i...

Q. What are the Signs used in acute pericarditis? • Pericardial friction rub is pathognomonic of pericarditis. It is heard as a phasic scatching sound. It may vary with phases

Define absorption, Define Absorption, Storage and Elimination of niacin? ...

Define Absorption, Storage and Elimination of niacin? Nicotinic acid and nicotinamide are rapidly absorbed from the intestine rather than the stomach. At low concentrations, a

What is the significance of lignin for the xylem formation, What is the sig...

What is the significance of lignin for the xylem formation? Lignin is vital because it is deposited on the cell wall of the xylem cells providing impermeability and rigidity to

Treatment of acute myocardial infarction, Q. Streptokinase is a substance u...

Q. Streptokinase is a substance used in the treatment of acute myocardial infarction. How does this substance act? Substances known as fibrinolytics, like urokinase and strepto

Explain the physical methods to control microorganisms, Explain the Physica...

Explain the Physical Methods to Control Microorganisms? The physical methods to control microorganisms involve heat, filtration or radiations. Figure illustrates these methods.

Dna replication in eukaryotes, DNA replication in eukaryotes is much more c...

DNA replication in eukaryotes is much more complex than in prokaryotes while there are various same aspects. The Eukaryotic cells can only initiate DNA replication at a particular

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd