Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
REFLEX ACTION -
Some common reflex actions are -
1. Coughing
2. Yawning
3. Sneezing
4. Knee-jerk reflex
5. Bleenking of eyes
6. Scratch reflex
EXAMPLE -
1. Cycling.
2. Watering of mouth.
3. Blinking of eyes in sharp light.
4. Withdrawal of leg in pithed frog.
5. Flow of bile from gall bladder.
6. Peristalasis.
7. Heart beat.
SIGNIFICANCE -
1. It enables animal to respond immediately to the harmful stimuli so that no harm is caused to it.
2. It gives more time to brain to work.
what is the Symptoms of VIBRIO PARAHAEMOLYTICUS Symptoms: A total of greater than one million organisms may cause disease. Symptoms of intoxication which range from mild to se
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Growing roots from different parts of plants Secure a box of sand and place it away from direct sunlight. Wet the sand thoroughly and keep it moist. Plant the following thi
Diet : Pre-operatively, patients are on low calorie, low fat diet. However in the immediate post-operative period, strict dieting is not advisable. They need good nutrition for p
LOCOMOTION IN STAR FISH - With the help of tube feet aided by fluid pressure in them. In a tube feet upper ampulla, middle podium and lower sucker present.
what is the meaning of direct and indirect respiration
Q. Do plants have tissue organization and specialized organs? Plants have specialized organs (like roots, limbs, reproductive organs, leaves) and differentiated tissues (suppor
A plant grown from one of Mendel's yellow peas is selfed. Five progeny peas are obtained from this self and they are all yellow. If the original selfed plant had been homozygous, w
Consider a time when the membrane voltage of a SA node cell in the heart is at its minimum value (near -80 mv). At this time, A. all the voltage-gated calcium channels will be
Q. What is the mitosis? What is the significance of mitosis? Mitosis is the process in which one eukaryotic cell divides into two cells identical to the parent cell generally i
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd