Reflex action, Biology

Assignment Help:

REFLEX ACTION -

  • Marshel Hall discovered reflex action. Best & Taylor defined it. Reflex action is functional unit of CNS.
  • It is sudden, immediate involuntary action against external stimuli. In man it is poly-synaptic.
  • If we prick needle on skin, somatic sensory nerves bring impulses to grey matter. Here these are analysed & order is given to muscle by motor nerve.
  • The path from which impulse is passed is reflex arch.
  • Minimum time is consumed in it. It is not under control of brain.

Some common reflex actions are -

1. Coughing

2. Yawning

3. Sneezing

4. Knee-jerk reflex

5. Bleenking of eyes

6. Scratch reflex

EXAMPLE -

1.       Cycling.

2.       Watering of mouth.

3.       Blinking of eyes in sharp light.

4.       Withdrawal of leg in pithed frog.

5.       Flow of bile from gall bladder.

6.       Peristalasis.

7.       Heart beat.

2243_reflex action.png

SIGNIFICANCE -

1. It enables animal to respond immediately to the harmful stimuli so that no harm is caused to it.

2. It gives more time to brain to work.


Related Discussions:- Reflex action

What is the symptoms of vibrio parahaemolyticus, what is the Symptoms of VI...

what is the Symptoms of VIBRIO PARAHAEMOLYTICUS Symptoms: A total of greater than one million organisms may cause disease.  Symptoms of intoxication which range from mild to se

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Growing roots from different parts of plants, Growing roots from different ...

Growing roots from different parts of plants Secure a box of sand and place it away from direct sunlight. Wet the sand thoroughly and keep it moist. Plant the following thi

Diet-peri operative problems, Diet :  Pre-operatively, patients are on low...

Diet :  Pre-operatively, patients are on low calorie, low fat diet. However in the immediate post-operative period, strict dieting is not advisable. They need good nutrition for p

Locomotion in star fish, LOCOMOTION IN STAR FISH - With the help of tub...

LOCOMOTION IN STAR FISH - With the help of tube feet aided by fluid pressure in them. In a tube feet upper ampulla, middle podium and lower sucker present.

Respiration, what is the meaning of direct and indirect respiration

what is the meaning of direct and indirect respiration

Tissue organization and specialized organs, Q. Do plants have tissue organi...

Q. Do plants have tissue organization and specialized organs? Plants have specialized organs (like roots, limbs, reproductive organs, leaves) and differentiated tissues (suppor

What would be the probability of obtaining result, A plant grown from one o...

A plant grown from one of Mendel's yellow peas is selfed. Five progeny peas are obtained from this self and they are all yellow. If the original selfed plant had been homozygous, w

Determine the membrane voltage of a sa node cell, Consider a time when the ...

Consider a time when the membrane voltage of a SA node cell in the heart is at its minimum value (near -80 mv).  At this time, A. all the voltage-gated calcium channels will be

Illustrate mitosis and define significance of mitosis, Q. What is the mitos...

Q. What is the mitosis? What is the significance of mitosis? Mitosis is the process in which one eukaryotic cell divides into two cells identical to the parent cell generally i

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd