Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
REFLEX ACTION -
Some common reflex actions are -
1. Coughing
2. Yawning
3. Sneezing
4. Knee-jerk reflex
5. Bleenking of eyes
6. Scratch reflex
EXAMPLE -
1. Cycling.
2. Watering of mouth.
3. Blinking of eyes in sharp light.
4. Withdrawal of leg in pithed frog.
5. Flow of bile from gall bladder.
6. Peristalasis.
7. Heart beat.
SIGNIFICANCE -
1. It enables animal to respond immediately to the harmful stimuli so that no harm is caused to it.
2. It gives more time to brain to work.
Barbiturate, Sedative, Hypnotic or Anxiolytic Intoxication and Withdrawal: This Emergencies related to substance abuse may be acute or chronic. The patient may come to th
using examples of invertebrate phyla illustrate how the increase in complexity is reflected by their nervous system?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
how does temperature affect the rate of cellular respiration? please explain with great detail!
Q. What are the Signs used in acute pericarditis? • Pericardial friction rub is pathognomonic of pericarditis. It is heard as a phasic scatching sound. It may vary with phases
Define Absorption, Storage and Elimination of niacin? Nicotinic acid and nicotinamide are rapidly absorbed from the intestine rather than the stomach. At low concentrations, a
What is the significance of lignin for the xylem formation? Lignin is vital because it is deposited on the cell wall of the xylem cells providing impermeability and rigidity to
Q. Streptokinase is a substance used in the treatment of acute myocardial infarction. How does this substance act? Substances known as fibrinolytics, like urokinase and strepto
Explain the Physical Methods to Control Microorganisms? The physical methods to control microorganisms involve heat, filtration or radiations. Figure illustrates these methods.
DNA replication in eukaryotes is much more complex than in prokaryotes while there are various same aspects. The Eukaryotic cells can only initiate DNA replication at a particular
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd