Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Why Vegetable and Fruit are important for human body?
The vegetables and fruits add colour and variety to our diets in addition to providing a host of essential nutrients and phytonutrients that help to prevent chronic degenerative diseases. The fruils are also high in potassium and help to establish a proper balance between the sodium and potassium content of our diets. An often-neglected group, this group provides for the water-soluble vitamins and minerals, so vital for the proper functioning of the body's various mechanisms. These delicious natural capsules of vitamins and minerals offer protection against many diseases, especially, heart diseases and certain types of cancer.
Most important is the fact that it offers a variety in terms of texture, colour and flavour and thus helps to avoid monotony in the meal. Green leafy vegetables are rich sources of various nutrients such as iron, calcium, p-carotene, folic acid and vitamin C, the amount being much more in the darker leaves. Their contribution to energy intake is very low, usually less than 2-3%. Yellow-orange coloured vegetables are rich in p-carotene. They must therefore be included at least four to five times in our diets. We can say adding colour to our diet will add colour to our life: The citrus fruit such as oranges, sweet-lime (mosmbi) and also, papaya and guavas are rich in vitamin C and the yellow-orange ones such as mango and papaya are rich in p-carotene. Fruits with high water content such as melons have low energy content, while dry fruits such as dates and raisins are high in energy.
Q. What are the main factors that affect the growth of a population? The major factors that make populations grow are births and immigration. The major factors that make popula
how get a aids
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Ribonucleases and deoxyribonucleases These enzymes are responsible for the degradation of dietary nucleic acids. Ribonucleases and deoxyribonucleases secreted by the
Vertebrate Eye - Adult Eye There are no main differences in the structure or composition of the eyes among different vertebrates. This should be clear to you from the diagram
Define Plasma or serum ascorbic acid levels? The serum or plasma ascorbic acid levels are used as an index of ascorbic acid nutrition of humans. The normal serum values vary ov
Suppose a sample of 200 microliters of blood needs to be diluted 1/50. How much diluents should be added and what will be the final volume? Show all steps.
Nutritional care can be recognized as both a science and art. Can you tell why? It is considered as a science because the raped advances in scientific knowledge provides all h
BIOLOGY IN ANCIENT INDIA - L A T E STONE AGE [10,000 - 20, 000 B.C) Man first cultivated wheat, barley, lentils & peas. In India rice was first cultivated at Meherga
Q. What is mitral stenosis? Most common cause of mitral stenosis is rheumatic fever. Nearly 30 per cent of patients with rheumatic fever may go on to develop pure mitral valve
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd