Explain the periodic table of the elements, Biology

Assignment Help:

Explain the periodic table of the elements ?

Periodic Table of the Elements :  An element is a pure substance composed of atoms all of a single kind. It cannot be broken down chemically into different forms of matter. About 92 elements occur in nature, and others, with atomic numbers 93 to 112, can be made in the laboratory. Living organisms contain only about 20 elements in more than minute quantities.

Names and properties of elements are listed in a chart called the Periodic Table of the Elements. The properties of an element can be predicted to some extent by its position in the Periodic Table.

727_Periodic Table of the Elements.png

In the table, each element is represented by a symbol. The number of protons in an atom is called the atomic number, and by convention the atomic number is listed at the lower left of the symbol as a subscript. The superscript to the left upper corner of the symbol is the atomic mass (mass number), or the approximate mass of the specific isotope of that element.

Isotopes are forms of an element with different atomic masses that occur because the number of neutrons in the nucleus can vary without essentially changing chemical properties of the element. In other words, isotopes behave exactly alike in terms of how they interact electrically with other elements, even though their masses differ, because neutrons are electrically neutral.

Most elements have two or more isotopes. Most hydrogen atoms are made of one proton and one electron. However, in nature, about 1 out of every 6,500 hydrogen atoms has a neutron as well as a proton in its nucleus. This isotope is called deuterium; its symbol is written 2H.


Related Discussions:- Explain the periodic table of the elements

Kind of tetrasporic embruo sac, what are the kinds of tetrasporic embryo sa...

what are the kinds of tetrasporic embryo sac...detail information

The digestive processes, Alimentary tract The alimentary tract and the ...

Alimentary tract The alimentary tract and the secretary organs associated with it are involved in the process of digestion. The sequence of events includes ingestion of food, d

Floriculture, Floriculture: This is the cultivation and development of com...

Floriculture: This is the cultivation and development of commercially important floral plants like rose, lilies, etc. Floriculture is called flower farming is a discipline of hort

State the term cercaria, State the term Cercaria? A stage in the life c...

State the term Cercaria? A stage in the life cycle of trematode flukes. Cercaria develops from redia found in intermediate host. This tadpolelike organism is released from inte

What are the three periods into which interphase is divided, What are the t...

What are the three periods into which interphase is divided? Interphase is the preceding phase to the mitotic division. It is separated into three periods, G1, S and G2 (the l

Vitamins, write a comprehensive note on vitamins?

write a comprehensive note on vitamins?

Radial cleavage - metazoa, Radial cleavage - Metazoa Radial cleavage p...

Radial cleavage - Metazoa Radial cleavage produces tiers or layers of cells one on top of another. Radial cleavage is also said to be indeterminate or regulative because each

What do you know about tricuspid stenosis, Q. What do you know about Tricus...

Q. What do you know about Tricuspid stenosis? It is rare disease, with rheumatic etiology seen in 90 per cent of cases. In patients with rheumatic mitral stenosis only 3-5 per

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd