Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Food Intolerance?
What is food intolerance? How does it differ from food allergy? Food intolerance like food allergy is an adverse reaction to food. Food intolerance is different from food allergy in that it does not involve the body's immune system. Food intolerance is a digestive system response rather than an immune system response. It occurs when a food component irritates a person's digestive system or when a person is unable to properly digest or breakdown, the food. It is a non-allergic hypersensitivity, which can occur for variety of reasons.
It may be triggered by a physical reaction to a rood or food additive or caused by a metabolic reaction to an enzyme deficiency such as the inability to digest milk properly (lactose intolerance), by pharmacologic agents in foods, by food poisoning such as ingesting contaminated or spoiled fish, or a food idiosyncrasy such as sulphite-induced asthma. The situation is therefore rather different from a food allergy where a specific person's body for whatever reason reacts against a certain food. Here, the most likely causes are food intolerance or excessive consumption of a certain type of food. Many factors may contribute to food intolerance. In some cases, as with lactose intolerance, the person lacks the chemicals, called enzymes, necessary to properly digest certain proteins found in food. Also common are intolerances to some chemical ingredients added to food to provide colour, enhance taste and protect against the growth of bacteria. These ingredients include various dyes and monosodium glutamate (MSG), a flavour enhancer. Let us get to know about these factors in details.
Q. Introduction of Quality Attributes of Food? Seasonal fruits and vegetables are grown in plenty, and are available in their respective seasons in abundance. While choosing th
Define Functions of Carbohydrate - Source of energy? Glucose is a major source of energy for all the body cells. One gram of carbohydrate provides 4 Kcal. RBCs are particularly
If porifers shiw cell aggregate plan tgen how can they also shiw division of labour among cells
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Ulcerative enteritis (quail disease) Ulcerative enteritis, caused by Clostridium colinum, is found in chicken, quails, pheasants, turkeys and some other birds. Clostridial or
Deoxyribonucleic Acid (DNA) - polymer of nucleotides containing genetic information that codes for proteins Nucleotide - a monomer of DNA consisting of a ribose/deoxyribose sug
An enzyme isolated from a mutant bacterium grown at 20 degrees celsius works in a test tube at 20 degrees celsius but not at 37 degrees celsius( 37 degrees celsius is the temperatu
Review of Characteristics of Phylum Nematode and Its Position in Animal Classification? Nematodes may be free-living or parasites of plants or animals. however, all nematode
Define Basal Metabolism and Energy Expenditure at High Altitude? The energy and nutrient requirements depend upon total energy expenditure and metabolic rate of the individual.
Illustrate about Nervous System Functional unit of nervous system is neuron. Neuron is nerve cell. Information passes through neurons by nerve impulses. Nervous system corre
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd