Explain the food intolerance, Biology

Assignment Help:

Explain the Food Intolerance?

What is food intolerance? How does it differ from food allergy? Food intolerance like food allergy is an adverse reaction to food. Food intolerance is different from food allergy in that it does not involve the body's immune system. Food intolerance is a digestive system response rather than an immune system response. It occurs when a food component irritates a person's digestive system or when a person is unable to properly digest or breakdown, the food. It is a non-allergic hypersensitivity, which can occur for variety of reasons.

It may be triggered by a physical reaction to a rood or food additive or caused by a metabolic reaction to an enzyme deficiency such as the inability to digest milk properly (lactose intolerance), by pharmacologic agents in foods, by food poisoning such as ingesting contaminated or spoiled fish, or a food idiosyncrasy such as sulphite-induced asthma. The situation is therefore rather different from a food allergy where a specific person's body for whatever reason reacts against a certain food. Here, the most likely causes are food intolerance or excessive consumption of a certain type of food. Many factors may contribute to food intolerance. In some cases, as with lactose intolerance, the person lacks the chemicals, called enzymes, necessary to properly digest certain proteins found in food. Also common are intolerances to some chemical ingredients added to food to provide colour, enhance taste and protect against the growth of bacteria. These ingredients include various dyes and monosodium glutamate (MSG), a flavour enhancer. Let us get to know about these factors in details.


Related Discussions:- Explain the food intolerance

Introduction of quality attributes of food, Q. Introduction of Quality Attr...

Q. Introduction of Quality Attributes of Food? Seasonal fruits and vegetables are grown in plenty, and are available in their respective seasons in abundance. While choosing th

Define functions of carbohydrate - source of energy, Define Functions of Ca...

Define Functions of Carbohydrate - Source of energy? Glucose is a major source of energy for all the body cells. One gram of carbohydrate provides 4 Kcal. RBCs are particularly

Animal kingdom, If porifers shiw cell aggregate plan tgen how can they also...

If porifers shiw cell aggregate plan tgen how can they also shiw division of labour among cells

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Ulcerative enteritis (quail disease), Ulcerative enteritis (quail disease) ...

Ulcerative enteritis (quail disease) Ulcerative enteritis, caused by Clostridium colinum, is found in chicken, quails, pheasants, turkeys and some other birds. Clostridial or

Nucleic acids, Deoxyribonucleic Acid (DNA) - polymer of nucleotides contai...

Deoxyribonucleic Acid (DNA) - polymer of nucleotides containing genetic information that codes for proteins Nucleotide - a monomer of DNA consisting of a ribose/deoxyribose sug

What happens at the molecular level, An enzyme isolated from a mutant bacte...

An enzyme isolated from a mutant bacterium grown at 20 degrees celsius works in a test tube at 20 degrees celsius but not at 37 degrees celsius( 37 degrees celsius is the temperatu

Define characteristics of phylum nematode, Review of Characteristics of Phy...

Review of Characteristics of Phylum Nematode and Its Position in Animal Classification? Nematodes may be free-living or parasites of plants or animals. however, all nematode

Basal metabolism and energy expenditure at high altitude, Define Basal Meta...

Define Basal Metabolism and Energy Expenditure at High Altitude? The energy and nutrient requirements depend upon total energy expenditure and metabolic rate of the individual.

Illustrate about nervous system, Illustrate about Nervous System Functi...

Illustrate about Nervous System Functional unit of nervous system is neuron. Neuron is nerve cell. Information passes through neurons by nerve impulses. Nervous system corre

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd