microarrays, Biology

Assignment Help:
how can you find the coded genes for each piece of DNA?

Related Discussions:- microarrays

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Which molecules has more direct effect, Which of the following molecules ha...

Which of the following molecules has more direct effect in learning and memory? A) norepinephrine B) epinephrine C) glutamate D) acetylcholine E) glycine Please leave justification

Cleavage and gastrulation, Cleavage and Gastrulation Eventually, one s...

Cleavage and Gastrulation Eventually, one spermatozoon fuses with the ovum to r restore the diploid genomic condition and activates all the potentials in the fertilized egg ce

Define disadvantages of direct microscopic count, Define Disadvantages of D...

Define Disadvantages of Direct Microscopic Count? 1. Small cells are difficult to see under the microscope and may be missed. 2. It gives total count, i.e., both live and de

What is arterial switch operation explain briefly, What is arterial switch ...

What is arterial switch operation explain briefly? Arterial Switch Operation: Switching the Great arteries to restore the normal Ventriculoarterial connections. The coronary

What are main limitations on size that can be synthesized, What are main li...

What are main limitations on size that can be synthesized and how will that be change over next few years? A: Today, a 10kb gene or longer is built as part of the regular produ

Psychedelic drugs (hallucinogens), PSYCHEDELI C DRUGS (HALLUCINOGENS) - ...

PSYCHEDELI C DRUGS (HALLUCINOGENS) - They act mainly on CNS and greatly alter one's thoughts, feelings and perceptions, called psychedelic drugs. They cause optical or a

Strategies for genetic characterization and conservation, Strategies for ge...

Strategies for genetic characterization and conservation - During last 20 years concerted efforts have been made to create awareness among all the developmental organizations in th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd