Ureotelism - excretion, Biology

Assignment Help:

Ureotelism - Excretion

Terrestrial animals with restricted water availability in the environment are faced with the formidable task of water conservation. Since they cannot afford to use liberal quantities of water for excretion, ammonia is converted into a less toxic product.

In mammals and semi-terrestrial adult amphibians, the major nitrogenous excretory product is urea, which is less toxic and easily soluble. These animals are therefore called ureotelic. 

 


Related Discussions:- Ureotelism - excretion

Define proteins as structural elements and structural units, Define Protein...

Define Proteins as Structural Elements and Structural Units? The liver cell membrane analysis shows that this membrane contains 50-60% protein, 35% lipids and 5% carbohydrates.

Impact changes in diet in management of diabetes mellitus, Impact of change...

Impact of changes in diet in the management of diabetes mellitus Changes in diet are an essential component of comprehensive diabetes care and treatment.  In this section you w

Contrast the reproduction of bacteria with that of frogs, Contrast the repr...

Contrast the reproduction of bacteria with that of frogs. Bacteria replicate asexually by splitting in two. Frogs reproduce sexually by producing sperm and eggs. One sperm and

Access cavity perforation - types of root perforation, Access Cavity Perfor...

Access Cavity Perforation - Types of Root Perforation Can occur during access cavity perforation (specially in anterior) Due to misdirection of bur during access cavit

Personal protective equipment, Personal Protective Equipment These eq...

Personal Protective Equipment These equipments are essentially required during working to protect face, eyes, respiratory system hands and clothes. Additionally in various in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is Non chordates?, what are the general characters of nonchordates, ex...

what are the general characters of nonchordates, explain

Bacteria, write six characteristics of bacteria

write six characteristics of bacteria

Indications for surgery-pericardial diseases, Indications for Surgery :  O...

Indications for Surgery :  Once diagnosis of constrictive pericarditis is made and confirmed by chest X-ray, ECG, echocardiogram, CT, MRI scan, cardiac catheterisation and angio,

Describe aortic regurgitation murmur in chronic ar murmur, Describe Aortic ...

Describe Aortic Regurgitation Murmur in Chronic AR Murmur ? Characteristic: High pitched, decrescendo murmur, immediately after S2 and extending through and part or all of dias

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd