Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Ureotelism - Excretion
Terrestrial animals with restricted water availability in the environment are faced with the formidable task of water conservation. Since they cannot afford to use liberal quantities of water for excretion, ammonia is converted into a less toxic product.
In mammals and semi-terrestrial adult amphibians, the major nitrogenous excretory product is urea, which is less toxic and easily soluble. These animals are therefore called ureotelic.
Define Proteins as Structural Elements and Structural Units? The liver cell membrane analysis shows that this membrane contains 50-60% protein, 35% lipids and 5% carbohydrates.
Impact of changes in diet in the management of diabetes mellitus Changes in diet are an essential component of comprehensive diabetes care and treatment. In this section you w
Contrast the reproduction of bacteria with that of frogs. Bacteria replicate asexually by splitting in two. Frogs reproduce sexually by producing sperm and eggs. One sperm and
Access Cavity Perforation - Types of Root Perforation Can occur during access cavity perforation (specially in anterior) Due to misdirection of bur during access cavit
Personal Protective Equipment These equipments are essentially required during working to protect face, eyes, respiratory system hands and clothes. Additionally in various in
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what are the general characters of nonchordates, explain
write six characteristics of bacteria
Indications for Surgery : Once diagnosis of constrictive pericarditis is made and confirmed by chest X-ray, ECG, echocardiogram, CT, MRI scan, cardiac catheterisation and angio,
Describe Aortic Regurgitation Murmur in Chronic AR Murmur ? Characteristic: High pitched, decrescendo murmur, immediately after S2 and extending through and part or all of dias
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd