Explain the diarrhoeal management strategies, Biology

Assignment Help:

Explain the Diarrhoeal Management Strategies?

The diarrhoeal management strategies have had a major impact on less than 5 mortality rate. The distribution of ORS packets and necessary advice at health centers has made diarrhoeal management more effective. The anganwadi workers also store iron-folate tablets and ORS packets for distribution as and when required in villages. Mothers are counseled that the infants should continue to receive breast- feeding and older children should not go on starvation therapy during diarrhoea1 episode. Rehydration therapy through home made beverages and rehydration fluid is taught. Hygiene and principles of sanitation are reinforced for conlplete management.

In 2001, National Nutrition Mission (10" plan 2002-2007) has been announced to bring about a rapid reduction in undernutrition, reduction/elimination of micronutrient deficiezcies viz. iron, iodine and vitamin A. Utilizing PMGY funds BPL families can take-home food supplements for children 6-36 months of age from the anganwadi. Nutrition education by anganwadi workers and ANM's are promoted. The goal is to bring down the prevalence of underweight children less than 3 years from current ‘$ 47% to 40% and reduce prevalence of severe under nutrition in children of 0-6 years by 50%.


Related Discussions:- Explain the diarrhoeal management strategies

Cells, what are the buildings blocks of life?

what are the buildings blocks of life?

Pathophysiology of tricuspid regurgitation, Q. Pathophysiology of Tricuspid...

Q. Pathophysiology of Tricuspid regurgitation? Tricuspid regurgitation is associated with prominent venous filling waves and elevated right atrial venous pressures. Hepatic and

Define precautions for determination of inorganic phosphorus, Define Precau...

Define Precautions for Determination of Inorganic Phosphorus? 1. All reagents should be added in the order mentioned. 2. Allow 10 minutes for the colour to develop in each t

Determine the stabilized forms of natural colourants, Stabilized forms of n...

Stabilized forms of natural colourants The mimicking of the native environment in which a natural colour exists is just one way of producing a stabilized form. In this case, th

How are the lipids classified, Q. Concerning solubility, how are the lipids...

Q. Concerning solubility, how are the lipids classified? Oils and Fats are hydrophobic molecules, i.e., they are insoluble in water and non polar. Lipids in general are molecul

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are holandric genes, What are holandric genes? Holandric genes are...

What are holandric genes? Holandric genes are genes situated in the nonhomologous region of the Y chromosome. Holandric genes condition phenotypes that emerge only in men as in

What are some prophylactic measures against ascariasis, What are some proph...

What are some prophylactic measures against ascariasis? The main prophylactic calculates against ascariasis are: efficient washing of vegetables and other foods; basic sanitar

Explain advantages of using fungi as a source of protein, Organism:-Fungi  ...

Organism:-Fungi  Advantages:- Easy to harvest from culture medium. Texture of the fungi improves the functional properties of proteins. Disdvantages:-

Medical therapy for aortic stenosis, Q. Medical Therapy for aortic stenosis...

Q. Medical Therapy for aortic stenosis? Definitive therapy for aortic stenosis is surgical and medical therapy is only palliative. Infective endocarditis and rheumatic fever p

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd