N-terminal cysteine amino acid , Biology

Assignment Help:

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 


Related Discussions:- N-terminal cysteine amino acid

Determine the width of attached gingiva at implant site, Width of Attached ...

Width of Attached Gingiva at Implant Site The zone of attached gingiva needs to be intact and of adequate width to protect (by separating) the tissue around the implant. If it

Structures in the Dermis, list of the structures you would expect to find i...

list of the structures you would expect to find in the dermis.

Determine the steps for withdrawing the insulin, Determine the Steps for Wi...

Determine the Steps for Withdrawing the Insulin The important thing about measuring a dose is to use the front of the plunger not the back - Check doctor's prescription.

What are the illustrations of the criminal law, What are the illustrations ...

What are the illustrations of the criminal law? Illustrations of crimes' law: Illustrations of crimes are theft, reckless or murder behaviour. The major aim of illegal

Bud dormancy - plant growth substances, Bud Dormancy - Plant Growth Substan...

Bud Dormancy - Plant Growth Substances Environmental Factors The most important factor inducing dormancy appears to be photoperiod. Short days induce dormancy in many w

Which disorders is most likely to underlie, A healthy, primiparous (first-t...

A healthy, primiparous (first-time) mother delivered a healthy infant several hours ago, but the mother has experienced postpartum hemorrhage. Which of the following disorders is m

Explain about the weight cycling - energy balance, Explain about the Weight...

Explain about the Weight cycling - energy balance? There are a number of obese people who keep losing and gaining weight a number of times in their lives. This is called the Yo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd