Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.
ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG
M S L P Q S R W V A C F S I E G I L Y P
This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.
Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.
Q. Explain Type 2 Diabetes Mellitus? It is the most common form of diabetes accounting for 90-95% of patients with diabetes. Type 2 Diabetes Mellitus was previously called as N
Explain briefly about the selenium Toxicity? There is a narrow margin between the beneficial and harmful intakes of selenium. The level at which selenosis occurs is not well-de
Sympatric speciation can be regarded as speciation where parent species gives rise to a daughter species without the individuals of a species being separated by space or territory.
Q. How does the pancreatic juice participate in the digestion of proteins? What are the involved enzymes? The pancreas secretes trypsinogen that undergoing action of the enzyme
Deficiency of vitamin -A (hypovitaminosis-A) Vitamin A deficiency develops due to insufficient supply of the vitamin or its defective absorption from alimentary tract. The defi
These circular orifices are located at the upper ends of the outflow parts of the left and right ventricles respectively. The pulmonary orifice which is 3 cms, is 0.5 cm larger tha
How we can measure perimplant PD Perimplant PD should be measured routinely during maintenance appointment with a less probing force (0.2 to 0.3 N) as the tissue is more sensit
Alterations occuring in cereal & cereal products, legumes You are already aware of the chemical composition of cereals and pulses. We will now look into changes occurring in t
Determine the Factors that Influence manganese absorption? Let us now see which factors influence Mn absorption. Major factors which may influence the absorption of this min
How has the importance of the brain evolved from fishes to reptiles? From the least to the most difficult brain structure, it is evident that the brain, from fishes to beings o
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd