N-terminal cysteine amino acid , Biology

Assignment Help:

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 


Related Discussions:- N-terminal cysteine amino acid

Explain type 2 diabetes mellitus, Q. Explain Type 2 Diabetes Mellitus? ...

Q. Explain Type 2 Diabetes Mellitus? It is the most common form of diabetes accounting for 90-95% of patients with diabetes. Type 2 Diabetes Mellitus was previously called as N

Explain briefly about the selenium toxicity, Explain briefly about the sele...

Explain briefly about the selenium Toxicity? There is a narrow margin between the beneficial and harmful intakes of selenium. The level at which selenosis occurs is not well-de

Sympatric speciation, Sympatric speciation can be regarded as speciation wh...

Sympatric speciation can be regarded as speciation where parent species gives rise to a daughter species without the individuals of a species being separated by space or territory.

Pancreatic juice participate in the digestion of proteins, Q. How does the ...

Q. How does the pancreatic juice participate in the digestion of proteins? What are the involved enzymes? The pancreas secretes trypsinogen that undergoing action of the enzyme

Deficiency diseases-copper deficiency, Deficiency of vitamin -A (hypovitami...

Deficiency of vitamin -A (hypovitaminosis-A) Vitamin A deficiency develops due to insufficient supply of the vitamin or its defective absorption from alimentary tract. The defi

Aortic and pulmonary orifices, These circular orifices are located at the u...

These circular orifices are located at the upper ends of the outflow parts of the left and right ventricles respectively. The pulmonary orifice which is 3 cms, is 0.5 cm larger tha

How we can measure perimplant pd, How we can measure perimplant PD Peri...

How we can measure perimplant PD Perimplant PD should be measured routinely during maintenance appointment with a less probing force (0.2 to 0.3 N) as the tissue is more sensit

Explain the alterations occuring in cereal, Alterations occuring in cereal ...

Alterations occuring in cereal & cereal products, legumes You are already aware of the chemical composition of cereals and pulses.  We will now look into changes occurring in t

Determine the factors that influence manganese absorption, Determine the Fa...

Determine the Factors that Influence manganese absorption? Let us now see which factors influence Mn absorption. Major factors which may influence the absorption of this min

Importance of the brain evolved from fishes to reptiles, How has the import...

How has the importance of the brain evolved from fishes to reptiles? From the least to the most difficult brain structure, it is evident that the brain, from fishes to beings o

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd