N-terminal cysteine amino acid , Biology

Assignment Help:

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 


Related Discussions:- N-terminal cysteine amino acid

Cell biology, is the study of internal structure of cell included in cell b...

is the study of internal structure of cell included in cell biology or anatomy?

When staphylococcal occur, Staphylococci exist in air, dust, sewage, water,...

Staphylococci exist in air, dust, sewage, water, milk and food or on food equipment, environmental surfaces, humans and animals. Humans and animals are the primary reservoirs. Stap

Blood vessels - circulation, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Explain galactose metabolism, Galactose Metabolism Galactose  goes to t...

Galactose Metabolism Galactose  goes to the liver via portal blood and is phosphorylated by galactokinase togalactose-  1  -phosphate (GIP) using ATP as  a phosphate donor as s

Intracellular sodium concentration of the motor neuron, Intracellular sodiu...

Intracellular sodium concentration of the motor neuron A complete motor neuron is removed from a frog and placed in normal physiological saline at 1 AM.  The neuron is healthy.

Which are plant tissues that form the plant roots, Which are plant tissues ...

Which are plant tissues that form the plant roots? Roots have a central portion called medulla made of vascular tissue outer phloem and inner xylem. Medulla is delimited by per

What are the communication process steps, Q. What are the Communication pro...

Q. What are the Communication process steps?Communication process steps: 1. Rapport Building 2. Finding the Problem 3. Planning 4. Implementation of the Plan 5. Ter

Define procedure for determination of fungal and yeast count, Define Proced...

Define Procedure for Determination of Fungal and Yeast Count? Now carry out the exercise following the steps enumerated herewith: 1. Shake the food sample and aseptically tr

Explain a reason these cells are used instead of outer body, The cells lini...

The cells lining the inside of the cheek are frequently removed for making observations of basic cell structure. The cells are from stratified squamous epithelium. Explain a reason

What is sarcoplasmic reticulum, An increase in the calcium conductance of a...

An increase in the calcium conductance of all sarcoplasmic reticulum membranes of a skeletal muscle with no external forces on it leads to A. an increase in the amount of calci

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd