Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.
ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG
M S L P Q S R W V A C F S I E G I L Y P
This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.
Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Aortic Valve Repair : In, acquired AR associated with VSD and prolapse of a cusp, repair is often successful. VSD is closed and at the same time the prolapsed part o
Categorisation of Major Brain Functions As a framework, the major brain functions typically divided into modalities and domains. The major modalities are motor function and th
Cyclostomes - Regeneration in Vertebrates The larvae of the lampreys between the jawless primitive fishes are able to regenerate their amputated tail. Blastema is made at the
Define Signs and symptoms of iron deficiency anaemia? Since the level of haemoglobin is reduced in the blood, it causes paleness (pallor) on certain parts of the body. Initiall
Cut wings (ct) is an X chromosome (sex linked) recessive mutant of D melanogaster. Antennaless (al) is an autosomal recessive mutant. A cut, antennaless (homozygous) female is mate
SPERM A T OCY T OGENESIS In this process four spermatid develop from one PGC. (i) Multiplication phase The spermotogonia or sperm mother cells lie next to the b
Food Applications of alginate One of the most unusual properties of the alginates has been the ability of soluble alginate salts to produce attractive, edible gels or jellies.
Each of the three NADH molecules formed per turn of the cycle yields 3 ATPs and the one FADH2 yields 2 ATPs by oxidative phosphorylation (whereas some measurements indicate in whic
Illustrate the name of surgical needle The surgical needle is comprised of 3 parts: the needle point, the needle body, and the swaged (press-fit) end. Needle may be broadl
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd