Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.
ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG
M S L P Q S R W V A C F S I E G I L Y P
This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.
Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.
is the study of internal structure of cell included in cell biology or anatomy?
Staphylococci exist in air, dust, sewage, water, milk and food or on food equipment, environmental surfaces, humans and animals. Humans and animals are the primary reservoirs. Stap
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Galactose Metabolism Galactose goes to the liver via portal blood and is phosphorylated by galactokinase togalactose- 1 -phosphate (GIP) using ATP as a phosphate donor as s
Intracellular sodium concentration of the motor neuron A complete motor neuron is removed from a frog and placed in normal physiological saline at 1 AM. The neuron is healthy.
Which are plant tissues that form the plant roots? Roots have a central portion called medulla made of vascular tissue outer phloem and inner xylem. Medulla is delimited by per
Q. What are the Communication process steps?Communication process steps: 1. Rapport Building 2. Finding the Problem 3. Planning 4. Implementation of the Plan 5. Ter
Define Procedure for Determination of Fungal and Yeast Count? Now carry out the exercise following the steps enumerated herewith: 1. Shake the food sample and aseptically tr
The cells lining the inside of the cheek are frequently removed for making observations of basic cell structure. The cells are from stratified squamous epithelium. Explain a reason
An increase in the calcium conductance of all sarcoplasmic reticulum membranes of a skeletal muscle with no external forces on it leads to A. an increase in the amount of calci
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd