Aortic and pulmonary orifices, Biology

Assignment Help:

These circular orifices are located at the upper ends of the outflow parts of the left and right ventricles respectively. The pulmonary orifice which is 3 cms, is 0.5 cm larger than the aortic orifice. The aortic orifice is placed in front and to the right of the mitral orifice. The pulmonary orifice is placed above and to the left of the tricuspid orifice and the aortic orifice intervening between them. The pulmonary orifice is guarded by the pulmonary valve and the aortic orifice by the aortic valve. Each valve consists of three semilunar cusps. Each cusp is triangular. It has a convex edge which is attached to the part of the margin of the orifice. It has two free margins that meet at the apex of the cusp. Each cusp consists of a double fold of endocardium with some fibrous tissue in it. The region of the apex is thickened to form a nodule while crescentric parts near the free edges are called lunules.

903_Aortic and Pulmonary Orifices.png


Related Discussions:- Aortic and pulmonary orifices

Class of crustacea - branchiopoda, Class of Crustacea - Branchiopoda ...

Class of Crustacea - Branchiopoda These are small fresh water crustaceans. The trunk appendages are flattened and leaf like and are helpful for locomotion also respiration he

Can you explain deoxynivalenol mycotoxicosis, Q. Can you explain Deoxynival...

Q. Can you explain Deoxynivalenol Mycotoxicosis? During 1987, an outbreak estimated to have affected over 50,000 people in the State of Jammu and Kashmir, was traced to the c

Magnitude of healthcare needs, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Explain theory or principle of determination of coliforms, Explain Theory o...

Explain Theory or Principle of Determination of Coliforms? Coliforms are gram negative, non-spore forming, facultative anaerobic bacteria which produce acid and gas on lactose

What are the antigen-respective antibodies abo blood group, What are the an...

What are the antigens and the respective antibodies of the ABO blood group system? The ABO blood system contain the erythrocytic antigens A and B that can be attacked by the an

Respiration, define respiration in diffrent types of animals

define respiration in diffrent types of animals

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Phylogenetic systems of classification, Q. Phylogenetic systems of classifi...

Q. Phylogenetic systems of classification? As already pointed out 'earlier that in Phylogenetic system, the plants are classified according to their evolutionary relationships.

Electron transport inhibitors, Electron Transport Inhibitors Several  c...

Electron Transport Inhibitors Several  compounds, including specific drugs, chemicals  and antibiotics  have been known to inhibit the electron  transfer  reactions at specific

Gases are exchanged when living organisms breathe, Which two gases are exch...

Which two gases are exchanged when living organisms breathe? Oxygen and carbon dioxide are the gases exchanged when living organisms breathe.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd