Classification of multicellular animals - coelom, Biology

Assignment Help:

Classification of Multicellular Animals - Coelom

We know earlier that the pseudocoel gave animals specific selective benefits. Among other things, this fluid-tilled space worked as a hydrostatic skeleton increasing the efficiency of burrowing. However, in pseudocoelomates, organs lay loose in the body cavity. To circumvent this drawback, coelom evolved within mesoderm. The result was that the new body cavity, that is the coelom, came to be lined by mesodermal layer (peritoneal layer). The various organs also came to be suspended in the coelom through the mesodermal layer called mesenteries. This enabled the body wall to become much more muscular, with better developed longitudinal and circular muscles. The body cavity so became a more efficient hydrostatic skeleton now. The alimentary canal also became more muscular and more specialised. Various organs became better arranged in a much more stable way, without interfering with one another. The mesenteries as well served as a better medium for positioning blood vessels to the respective organs. So, development of coelom has been a main step in the evolution of more complex and larger animals.


Related Discussions:- Classification of multicellular animals - coelom

Explain the nucleolus, Q. Explain the nucleolus? The nucleolus is an op...

Q. Explain the nucleolus? The nucleolus is an optically and a small dense region in the interior of the cell nucleus. It is made of ribosomic proteins and RNA (rRNA). One nucle

What is leaf cuticle, What is leaf cuticle? Leaf cuticle is a thin waxy...

What is leaf cuticle? Leaf cuticle is a thin waxy layer made of waxes and cutin on the outer surface of the leaf epidermis. Its function is near control the cellular transpirat

What are the blood types of the abo blood system, What are the blood types ...

What are the blood types of the ABO blood system? The type A, the type B, the type AB and the type O are the blood types of the ABO blood system..

Main cytoplasmic structures present in animal cells, What are the main cyto...

What are the main cytoplasmic structures present in animal cells? Ans) The major cytoplasmic structures of the cell are the centrioles, the cytoskeleton, lysosomes, mitochondria

Indications for surgery-mixed tricuspid stenosi , Indications for Surgery: ...

Indications for Surgery:  In a mixed lesion, either regurgitation or stenosis may be dominant and decision of surgery depends on the haemodynarnics. At the time of surgery on othe

Define about the nutritional deficiencies, Define about the nutritional def...

Define about the nutritional deficiencies? The nutritional deficiencies which have been identified in the group of elderly are of total calories, protein, vitamin A, vitamin C,

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Quantitative changes, Quantitative changes The quantitative changes in...

Quantitative changes The quantitative changes in the availability of the active biomolecules occur in order to compensate for the loss of efficiency of the system caused by th

How do we treat protein energy malnutrition?, How do we Treat Protein Energ...

How do we Treat Protein Energy Malnutrition? Major objective of the treatment of PEM is to provide adequate energy and protein intake and control infections, if any. Mild and m

What is the function of lh in the menstrual cycle, What is the relationship...

What is the relationship between the estrogen level and the LH level in the menstrual cycle? What is the function of LH in the menstrual cycle and when does its blood concentration

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd