Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is plant coleoptile? Why does the removal of the coleoptile extremity disallow plant growth?
Coleoptile is first (one or more) aerial structure of the sprouting plant that emerges from the seed. It encircles the young stem and the first leaves, protecting them.
The top of coleoptile in general is the region where auxins are made. If this region is removed, plant growth stops since auxins are necessary to promote growth and tissue differentiation.
Asexual Reproduction in Animals Reproduction may be referred as production of true copies. Most of the animals that are quite familiar to us generate male and female gametes (
Role of Mesoderm and Ectoderm in Limb Morphogenesis A series of very interesting experiments on wing and leg buds of chick embryos have clarified the respective roles of meso
State the Continuous sutures Suturing technique It can be used to attach 2 surgical flap edges or to secure multiple interproximal papillae of one flap independently of the oth
Q. What is the action mechanism of the antiretroviral drugs known protease inhibitors which are used against HIV infection? Protease inhibitors are some of the antiretroviral d
Q. Find out risk factors for coronary disease? 1) Tobacco Smoking, the single most preventable cause of death is a leading risk factor for CAD, cerebrovascular accident and
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
complete assignment
How do taenias obtain food and make gas exchange? Tapeworms have hooks and sucking structures on their heads (scolex) that fixate the parasite in the gut wall; these structures
Advantages of mucoperiosteal flap There is no tissue loss It is advantageous in cases where there is deficiency of keratinized tissue and the soft tissue is not lost, but ma
STRESS OF HOSPITALIZATION Stress refers to the imbalance between the environmental and societal demands and the child's coping abilities and resources that puts them in a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd