Behaviour modifications for weight reduction plan, Biology

Assignment Help:

Define Behaviour and Life Style Modifications for Weight Reduction Plan?

Behaviour and life style modifications are an integral part of the weight reduction plan. They are based on analysis of behaviour associated with appropriate, as well as, inappropriate thinking and eating habits. The obese tend to overeat in certain situations which if controlled may help towards keeping the weight in check. Keeping a food diary, the act itself is associated with weight loss. This means that if an individual pays attention to when and what he/she eats, they tend to eat less. It should not be inferred from here that behaviour therapy avoids the need for restricting energy intake. That still remains the mainstay of the treatment. The individual must learn to correct the negative thoughts that accompany a dietary lapse, e.g., instead of thinking that I have wasted all my efforts, I ate a piece of cake today', they should think 'One slice of cake is not going to increase my weight'. This shift of thought process helps tremendously in continuing the effort to lose weight. The following strategies related to lifestyle modifications are helpful. You may advocate these to obese individuals.


Related Discussions:- Behaviour modifications for weight reduction plan

Functions of testis, Functions of Testis The testis performs the follo...

Functions of Testis The testis performs the following two functions: Proliferation of spermatozoa and Secretion of steroid hormones

Explain saquinavir, Explain Saquinavir Saquinavir (SQV, Fortovase, Invi...

Explain Saquinavir Saquinavir (SQV, Fortovase, Invirase) - When administered as a single protease inhibitor, a soft-gel preparation (Fortovase) with improved bioavailability an

Determine the amount of glucose in the blood, During a routine annual physi...

During a routine annual physical,a patient was checked to determine the amount of glucose in the blood.After the assay,It was found that the glucose that the glucose concentration

Birth marks (naevi) and vascular naevi, Birth Marks  (Naevi): Birth Ma...

Birth Marks  (Naevi): Birth Marks  is also known  as naevi.  It  is a multiplication  of  one or more cutaneous elements within  the skin. It  is defined  as a  congenital, ci

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain management strategies for genetically modified crops, Explain Manag...

Explain Management strategies for genetically modified crops? Crops that have been genetically modified (GM) to be toxic to insect pests are now common in US agriculture. Make

Can it be influenced by environmental factors, Variation exhibited in share...

Variation exhibited in shared traits present in a population is due to alleles of the shared genes. can be influenced by interactions of alleles of multiple genes. Can be influence

What is the difference between amnion and chorion, What is the difference b...

What is the difference between amnion and chorion? Amnion is the membrane that covers the embryo. Chorion is the membrane that covers the amnion, the yolk sac and the allantois

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd