Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Define Behaviour and Life Style Modifications for Weight Reduction Plan?
Behaviour and life style modifications are an integral part of the weight reduction plan. They are based on analysis of behaviour associated with appropriate, as well as, inappropriate thinking and eating habits. The obese tend to overeat in certain situations which if controlled may help towards keeping the weight in check. Keeping a food diary, the act itself is associated with weight loss. This means that if an individual pays attention to when and what he/she eats, they tend to eat less. It should not be inferred from here that behaviour therapy avoids the need for restricting energy intake. That still remains the mainstay of the treatment. The individual must learn to correct the negative thoughts that accompany a dietary lapse, e.g., instead of thinking that I have wasted all my efforts, I ate a piece of cake today', they should think 'One slice of cake is not going to increase my weight'. This shift of thought process helps tremendously in continuing the effort to lose weight. The following strategies related to lifestyle modifications are helpful. You may advocate these to obese individuals.
Functions of Testis The testis performs the following two functions: Proliferation of spermatozoa and Secretion of steroid hormones
Explain Saquinavir Saquinavir (SQV, Fortovase, Invirase) - When administered as a single protease inhibitor, a soft-gel preparation (Fortovase) with improved bioavailability an
whats polymorphic
During a routine annual physical,a patient was checked to determine the amount of glucose in the blood.After the assay,It was found that the glucose that the glucose concentration
Birth Marks (Naevi): Birth Marks is also known as naevi. It is a multiplication of one or more cutaneous elements within the skin. It is defined as a congenital, ci
case study haematology
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Management strategies for genetically modified crops? Crops that have been genetically modified (GM) to be toxic to insect pests are now common in US agriculture. Make
Variation exhibited in shared traits present in a population is due to alleles of the shared genes. can be influenced by interactions of alleles of multiple genes. Can be influence
What is the difference between amnion and chorion? Amnion is the membrane that covers the embryo. Chorion is the membrane that covers the amnion, the yolk sac and the allantois
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd