Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the pineal gland?
The pineal gland also known as epiphysis or pineal body is situated centrally in the head. It secretes the hormone melatonin. A hormone produced at night and related to the regulation of the circadian cycle or circadian rhythm and the wakefulness-sleep cycle. Melatonin possibly regulates a lot of body functions related to the night-day alternation.
Open Head Injuries Open head injuries are TBIs in which the skull is penetrated, as in gun shot or missile wounds, or in which fragment of bone penetrate the brain substance. O
Which of the following serves as an actuating signal, or as part of an actuating signal, in a negative feedback system? A. Blood plasma levels of Glucose. B. Blood plasma le
Theodosius Dobzhansky and Boris Spassky demonstrated the working of normalising selectioion a behavioural trait in two populations of Drosophida pseudobscura. The two populatiors w
Q. Define Myocardial infraction and stress testing? Prediction of disease is one of the primary functions of stress testing. We would like to be able to predict in each patient
Q. What do you mean by Punch cards? Punch cards are used when the number of taxa to be keyed out is large. In this type of cards the holes at numbers corresponding to a charact
Q. What do you mean by Binomial system in binomial nomenclature? In the previous sections we have outlined the concepts of binomial nomenclature at International level and the
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Impoundments - Lentic Ecosystems We have so far discussed natural lakes. In addition to these there are a number of lakes both small and large artificially created by man cal
Arthropods - Regeneration in Invertebrates Among arthropods like insects, crustaceans, centipedes, scorpions and spiders, the capability of regeneration is low or not present.
What is the formula for photosynthesis? H 2 O + 6CO 2 + Light Energy ----> C 6 H 12 O6+ 6O 2 6 molecules of water + 6 molecules of carbon dioxide --->1 molecule of glucose
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd