Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is mucoperiosteal flap
Silk is easy to handle, ties with a slip knot, and is relatively inexpensive compared with other nonabsorbable suture materials currently available. However, there are distinct disadvantages associated with silk. First, it is nonabsorbable so must be removed, usually a week or so later. Second, silk specifically is a multifilament that "wicks" or pulls bacteria and fluids into the wound site. Therefore silk is not the suture material of choice when any sterile materials are placed under a mucoperiosteal flap.
Where would a predicted silent mutation have to be situated to actually result in a loss-of-function mutation (and potentially lead to the onset of disease)? A. Intron-exon jun
Define Iron Status of the Individual Lastly, iron status of the individual is a floury determinant of how much iron is absorbed. On a mixed diet with some haem iron, the overal
Q. Describe Coronary Spasm? Usually spasm develops at the site of subcritical or critical stenoses, but it may also occur in angiographically normal coronary arteries, the so c
Explain the basic Concept of Energy? Energy in simple terms may be defined as the ability, or power, to do work. As a student of dietetics and nutrition, you already know that
What are the causes of obesity - Etiology? However simple the question may sound, the answer to it is not all that simple. We cannot deny that excess weight results from positi
Pullulan Pullulan is a water soluble edible microbial polysaccharide consisting of Maltotriose units (α 1 → 6), as shown in the figure 2.12. It is produced by yeast Aureobasi
Define Assessment of Chromium Status? No specific tests are currently available, which could help us to determine chromium status. Another reason being the chromium content of
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Nutrition Support for myocardial infarction patient? The nutrient requirements of a MI patient vary from time of getting hospitalized in an emergency to the time of getting
What are the Pupillary defects There are certain deviations from normal pupillary reflexes which point towards certain specific pathology.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd