What is mucoperiosteal flap, Biology

Assignment Help:

What is mucoperiosteal flap

Silk is easy to handle, ties with a slip knot, and is relatively inexpensive compared with other nonabsorbable suture materials currently available. However, there are distinct disadvantages associated with silk. First, it is nonabsorbable so must be removed, usually a week or so later. Second, silk specifically is a multifilament that "wicks" or pulls bacteria and fluids into the wound site. Therefore silk is not the suture material of choice when any sterile materials are placed under a mucoperiosteal flap.

 


Related Discussions:- What is mucoperiosteal flap

Explain the term- loss-of-function mutation, Where would a predicted silent...

Where would a predicted silent mutation have to be situated to actually result in a loss-of-function mutation (and potentially lead to the onset of disease)? A. Intron-exon jun

Define iron status of the individual, Define Iron Status of the Individual ...

Define Iron Status of the Individual Lastly, iron status of the individual is a floury determinant of how much iron is absorbed. On a mixed diet with some haem iron, the overal

Describe coronary spasm, Q. Describe Coronary Spasm? Usually spasm deve...

Q. Describe Coronary Spasm? Usually spasm develops at the site of subcritical or critical stenoses, but it may also occur in angiographically normal coronary arteries, the so c

Explain the basic concept of energy, Explain the basic Concept of Energy? ...

Explain the basic Concept of Energy? Energy in simple terms may be defined as the ability, or power, to do work. As a student of dietetics and nutrition, you already know that

What are the causes of obesity - etiology, What are the causes of obesity -...

What are the causes of obesity - Etiology? However simple the question may sound, the answer to it is not all that simple. We cannot deny that excess weight results from positi

Explain pullulan, Pullulan Pullulan is a water soluble edible microbial...

Pullulan Pullulan is a water soluble edible microbial polysaccharide consisting of Maltotriose units (α 1 → 6), as shown in  the figure 2.12. It is produced by yeast  Aureobasi

Define assessment of chromium status, Define Assessment of Chromium Status?...

Define Assessment of Chromium Status? No specific tests are currently available, which could help us to determine chromium status. Another reason being the chromium content of

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Nutrition support for myocardial infarction, Q. Nutrition Support for myoca...

Q. Nutrition Support for myocardial infarction patient? The nutrient requirements of a MI patient vary from time of getting hospitalized in an emergency to the time of getting

What are the pupillary defects, What are the Pupillary defects There ar...

What are the Pupillary defects There are certain deviations  from normal pupillary reflexes which point towards certain specific pathology.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd