When to use the term 2'' carbon, Biology

Assignment Help:

When do you use the term 2' carbon and when do you use 2 carbons on a molecular structure? I need examples please!


Related Discussions:- When to use the term 2'' carbon

Marchantia , why vegetative reproduction use in marchantia

why vegetative reproduction use in marchantia

Cryo preserved allografts -surgical techniques, Cry o Preserved Allograf...

Cry o Preserved Allografts (Homograft) :  As these are not mounted, a free hand suturing in two layers has to be done. The valve is thawed by protocol. The septal muscle i

Differences between genomes in prokaryotes and eukaryotes, What are the dif...

What are the differences between genomes in prokaryotes vs. eukaryotes?

Rapidly flowing waters - biota of rivers, Rapidly Flowing Waters - Biota of...

Rapidly Flowing Waters - Biota of Rivers In the rapidly flowing section of the river, the water current is the dominant feature. Everything that is not attached or weighed is

Origin of endoplasmic reticulum, ORIGIN OF E.R. (1 )      Originates...

ORIGIN OF E.R. (1 )      Originates from plasma membrane. (2 )      According to Haguenau, E.R.originates from Nebenkern (Germ center). Nebenkern is a group of conce

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain yellow fever, Yellow Fever  Yellow fever vaccine, a single-dose...

Yellow Fever  Yellow fever vaccine, a single-dose attenuated live virus vaccine prepared in eggs, should be given at least 10 days before travel to endemic areas, which include

Dimentia, i dont know how to start

i dont know how to start

Explain the occurrence of vitamin B1, Explain the Occurrence of Vitamin B 1...

Explain the Occurrence of Vitamin B 1 Vitamin B 1   occurs widely in the vegetable  kingdom. The richest sources for vitamin B 1 , as you may already know, are yeast, grain ge

Predation and coevolution, You now know that natural seleqtion aims at evo...

You now know that natural seleqtion aims at evolving adaptations of organisms in response to environmental changes in the inanimate world. Also many adaptations arise due to intera

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd