What is monohybridism, Biology

Assignment Help:

What is monohybridism?

Monohybridism is the study of only one feature in the crossing of two pure individuals (hybridization) for that characteristic.

 


Related Discussions:- What is monohybridism

Explain scope of food science and technology as a subject, Explain Scope of...

Explain Scope of Food Science and Technology as a Subject? Food science and technology has developed as a discipline to systematically organize and link various kinds of knowle

Describe food applications of alginate, Food Applications of alginate O...

Food Applications of alginate One of the most unusual properties of the alginates has been the ability of soluble alginate salts to produce attractive, edible gels or jellies.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the reagents and products of fermentation, In general what are the...

In general what are the reagents and products of fermentation? In fermentation glucose (sugar) is degraded into pyruvic acid (every glucose molecule forms two pyruvic acid mole

What is firing rate of carotid artery baroreceptors, What is firing rate of...

What is firing rate of carotid artery baroreceptors At 1:00 AM, person X's blood pressure is equal to the blood pressure set point.  At 1:01 AM, there is a decrease in the firi

What are the major cellular features of fungi, Q. What are the major cellul...

Q. What are the major cellular features of fungi? There are pluricellular and unicellular fungi. All fungi are heterotrophs and eukaryotes. Fungi have cells with cell wall m

What do you mean by taxonomist, Q. What do you mean by Taxonomist? Mode...

Q. What do you mean by Taxonomist? Modern classification systems are based on many types of evidence. A truly natural classification is obtained from analysis and harmonisation

Sausage manufacture - meat products, Sa u s a g e manufacture Saus...

Sa u s a g e manufacture Sausage enjoys a prime place among various meat products. Major advancements in processing technology (rapid curing, hot processing, use of solubl

List a few important uses of food hydrocolloids, List a few important uses ...

List a few important uses of food hydrocolloids. A few important uses of food hydrocolloids are: to increase viscosity and to stabilize food products. Its other uses  include u

Define importance of body composition assessment in athletes, Define Import...

Define Importance of Body composition assessment in athletes? Body composition and weight are two of the many factors that contribute to optimal exercise performance. Body weig

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd