Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is Catharanthus roseus pharmaceutical compounds?
This species yielded the alkaloids vincristine and vinblastine. Traditionally used by various cultures for the treatment of diabetes, these compounds were first discovered as part of an investigation of the plant as a possible oral hypoglycemic. Originally native to Madagascar, this species is now widespread and common. The vinca alkaloids are used in the treatment of childhood leukemia and Hodgkin's disease.
Normal or General Diet This diet is planned to be consistent with the Recommended Dietary Allowances (RDAs) of nutrients and is based on the food groups. It is usuall
Vital Signs of clinical evaluation Patient's clinical evaluation starts with the examination of certain vital signs which are: B.P. (Take average of two regarding with atlea
mentions chareacteristics and classificaton of protozoa?
Elaborate the following term in detail - Macronucleus. One of two types of dimorphic nuclei found in ciliate protozoans. Macronucleus contains multiple copies of genome (polypl
Explain the Female Reproductive System? The female reproductive system consists of the primary sex organs, the ovaries, and the accessory organs necessary to effect fertilizati
Which of the following best defines why the two DNA polymerase proteins that are held by the sliding clamp are oriented in opposite directions? A. The efficiency of replication
Zymogen :- an inactive form of an enzyme; becomes active prior to its action.
Insect resistant crops (IRC) Should reduce use of insecticides. This is beneficial to environment because: - More beneficial insects around as they are not killed by in
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
K e to s i s It is also known as acetonemia in bovines or pregnancy toxaemia in sheep and is associated with ketonemia, ketonuria and low blood glucose. E t iol
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd