What is catharanthus roseus pharmaceutical compounds, Biology

Assignment Help:

Q. What is Catharanthus roseus pharmaceutical compounds?

This species yielded the alkaloids vincristine and vinblastine. Traditionally used by various cultures for the treatment of diabetes, these compounds were first discovered as part of an investigation of the plant as a possible oral hypoglycemic. Originally native to Madagascar, this species is now widespread and common. The vinca alkaloids are used in the treatment of childhood leukemia and Hodgkin's disease.


Related Discussions:- What is catharanthus roseus pharmaceutical compounds

Explain concept of normal diet, Normal or General Diet This diet is pl...

Normal or General Diet This diet is planned to be  consistent with the  Recommended Dietary Allowances (RDAs) of  nutrients  and  is based  on  the food groups.  It  is  usuall

Vital signs of clinical evaluation, Vital Signs of clinical evaluation ...

Vital Signs of clinical evaluation Patient's clinical evaluation starts with the examination of certain vital signs which are: B.P. (Take average of two regarding with atlea

Protozoa, mentions chareacteristics and classificaton of protozoa?

mentions chareacteristics and classificaton of protozoa?

Elaborate the following term in detail - macronucleus, Elaborate the follow...

Elaborate the following term in detail - Macronucleus. One of two types of dimorphic nuclei found in ciliate protozoans. Macronucleus contains multiple copies of genome (polypl

Explain the female reproductive system, Explain the Female Reproductive Sys...

Explain the Female Reproductive System? The female reproductive system consists of the primary sex organs, the ovaries, and the accessory organs necessary to effect fertilizati

Why the two dna polymerase proteins are oriented in opposite, Which of the ...

Which of the following best defines why the two DNA polymerase proteins that are held by the sliding clamp are oriented in opposite directions? A. The efficiency of replication

Explain zymogen, Zymogen :- an  inactive form of an  enzyme; becomes active...

Zymogen :- an  inactive form of an  enzyme; becomes active prior to its action.

Define insect resistant crops in ecological way, Insect resistant crops (IR...

Insect resistant crops (IRC) Should reduce use of insecticides. This is beneficial to environment because:  -  More beneficial insects around as they are not killed by in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Ketosis, K e to s i s It is also known as acetonemia in bovines or...

K e to s i s It is also known as acetonemia in bovines or pregnancy toxaemia in sheep and is associated with ketonemia, ketonuria and low blood glucose. E t iol

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd