Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Determine about the Manganese
Manganese performs some functions in photosynthesis and acts to regulate the intake of certain elements and their oxidation states. Several crops have been found to be lower in reducing sugar and sucrose when the Mn2+ supply is limited. Also sugar content from sugarcane is higher where there is ample manganese supply.
An excess of manganese induces chlorosis due to inactivity of iron because of its oxidation by manganese. The deficiency results in a limited development of chlorophyll and as chlorosis. Excess iron brings about symptoms of manganese deficiency. The optimum ratio of Fe/Mn is 2.0 for plant growth.
Q. What is the mechanism by which the neural impulse is transmitted along the axon? The neural impulse is transmitted along the neuronal membrane through depolarization of cons
Define the General Mortality and Morbidity Risk? Obesity increases the risk of morbidity and mortality. The obese are more prone to developing morbidities or other chronic dise
what is an ecosystem energy pathway
Determine about the The Halstead Category Test This test is a concept identification procedure in which the subject must discover the method or principle that governs various
Q. How different is the simple cuboidal epithelium from the columnar epithelium? Where can these epithelia are found in the human body? The simple cuboidal epithelium is made o
Explain various chemical formulas? Chemical Formulas A molecule can be represented in any of three ways: its chemical formula, structural formula, or Lewis diagram. A chemic
Explain holding method of pasteurization In the holding method of pasteurization (62 o C for 30 minutes) or the high-temperature short-time (HTST), 71 o C for 15 minutes method
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Evidence of coverage of Ecology Evidence of coverage of Ecology and Evolution to the level of Descriptor 2 and an evaluation or discussion that shows depth of underst
make a assignment of pond succesion
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd