What is bone remodeling, Biology

Assignment Help:

Bone Remodeling

Bone remodeling differs from the other means of bone structure alteration in that osteoblasts and Osteoclasts do not act independently but are coupled and bone resorption and formation occur at the same spot on a bone surface. It represents a change that occurs within mineralised bone without concomitant alteration of architecture of the tissue.

 


Related Discussions:- What is bone remodeling

Define ziehl-neelsen staining technique, Define Ziehl-Neelsen Staining Tech...

Define Ziehl-Neelsen Staining Technique? Ziehl-Neelsen staining is used for staining these bacteria. The technique was discovered first by Robert Koch during his pioneering inv

What is the phototropism, What is the phototropism? The Phototropism is...

What is the phototropism? The Phototropism is the movement of plant structures in response to light. The Phototropism may be negative or positive. The Positive phototropism is

Define conjugation in brief, Define Conjugation in brief. A form of se...

Define Conjugation in brief. A form of sexual reproduction in ciliates (Ciliophora). During conjugation two ciliate protozoans join and macronuclei disappears. After meiotic d

What elements are present in a lipid, a) What are the two types of chemical...

a) What are the two types of chemical compound which combine to form a lipid? b) What elements are present in a lipid? a) Lipids are formed from the combination of

Major types of inheritances exceptions to mendel''s rules/, According to th...

According to the Mendel's law the phenotypical characteristics would be determined by pair of factors (alleles) that separate independently in gametes. What are the major types of

What are classes into which the phylum arthropoda is divide, Q. What are th...

Q. What are the classes into which the phylum Arthropoda is divided? What are the three major ones and some of their representative species? The three main classes of arthropod

Determine a testable hypothesis, A friend of yours suggests that the origin...

A friend of yours suggests that the origin of life on earth is extraterrestrial in origin (an idea known as panspermia). Can you propose a testable hypothesis to determine if this

Mention causes of implant failure, Mention causes of implant failure due to...

Mention causes of implant failure due to improper implant selection. Implant selection errors : a) Improper implant type in improper bone type. b) Improper length, width

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd