Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Bone Remodeling
Bone remodeling differs from the other means of bone structure alteration in that osteoblasts and Osteoclasts do not act independently but are coupled and bone resorption and formation occur at the same spot on a bone surface. It represents a change that occurs within mineralised bone without concomitant alteration of architecture of the tissue.
Define Ziehl-Neelsen Staining Technique? Ziehl-Neelsen staining is used for staining these bacteria. The technique was discovered first by Robert Koch during his pioneering inv
what is filter feeding?..
What is the phototropism? The Phototropism is the movement of plant structures in response to light. The Phototropism may be negative or positive. The Positive phototropism is
Define Conjugation in brief. A form of sexual reproduction in ciliates (Ciliophora). During conjugation two ciliate protozoans join and macronuclei disappears. After meiotic d
a) What are the two types of chemical compound which combine to form a lipid? b) What elements are present in a lipid? a) Lipids are formed from the combination of
According to the Mendel's law the phenotypical characteristics would be determined by pair of factors (alleles) that separate independently in gametes. What are the major types of
Q. What are the classes into which the phylum Arthropoda is divided? What are the three major ones and some of their representative species? The three main classes of arthropod
A friend of yours suggests that the origin of life on earth is extraterrestrial in origin (an idea known as panspermia). Can you propose a testable hypothesis to determine if this
Mention causes of implant failure due to improper implant selection. Implant selection errors : a) Improper implant type in improper bone type. b) Improper length, width
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd