Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Describe the Technique of Operation in prosthetic valve endocarditis?
The operative principle is drainage of abscess, removal of debris and valve rep or replacement to reverse haemodynamic abnormality. Any acquired defect like VSD ring abscess, fistula or aneurysm has to be repaired. In children congenital lesion is also rectified.
Availability of intra operative TEE is absolutely essential during surgery. Cardiopulmonary bypass with aortic and bicaval cannulae is instituted. Antegrac and retrograde cardioplegia are administered. Manipulation of heart is kept to a minimum for fear of embolism. For aortic valve endocarditis inspection of anterior mitral leaflet and chordae for drop lesions is a routine procedure. Mitra valve may be repaired and valve perforation could be closed with pericardial patch if infection is under contl-01.
When valve replacement is necessary, the valve is excised and careful check for abscess is done. If present it is drained and debridement done. Abscess that burrows deeper could cause aortoventricular or atrioventricular separation.
Interrupted sutures with pericardial patches are used to treat this and anchor the valve. Larger disruptions are managed with autologus or bovine pericardial patches. The advantage of a bioprosthesis over mechanical valve in preventing re infection has not been proved conclusively. However, for aortic prosthetic valve endocarditits a cryopreserved, free homograft is the best choice. In such cases if there is extensive abscess formation and disruption of aoi-to-ventricular continuity homograft aortic root replacement with re-implantation of coronaries is the preferred technique.
a) Explain the polygonum type of embryo sac. Why is it generally referred to as monosporic ? b) Explain human leucocyte antigen complex? Describe its role in organ transplantati
Bacillary Dysentery: You have learnt about the diarrhoea in the foregoing sub-section, now let us take for example a child who has loose motion which contains blood and mucus
How are the male gametophytes and the male gametes formed in angiosperms? In the anthers of every stamen there are pollen sacs. Within the pollen sacs there are microspore moth
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain about the Food Spoilage? Foods gradually undergo deterioration or spoilage from the time they are harvested, caught, slaughtered or manufactured. Therefore, delay in th
How many chambers do the bird heart and the mammalian heart have? Concerning temperature maintenance what is the advantage of the double and complete circulation of these animals?
What are sieve tubes suited for translocation of food? a.bordered pits b.no end walls c.bordered lumen and perforated cross walls D.no protoplasm
How Ignorance and Poor Socioeconomic cause PEM? Status Improper childcare, either as a result of lack of knowledge or lack of time for mother, could also contribute to the onse
There are three steps of PCR a) Denaturation. The reaction combination is heated to 95°C for a short time period (about 15-30 sec) to denature the goal DNA into one strands w
Q. What is the kind of cell division that allows sexual reproduction? What is gametogenesis? Meiosis is the kind of cell division that permits sexual reproduction since it redu
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd