Describe technique operation prosthetic valve endocarditis, Biology

Assignment Help:

Describe the Technique of Operation in prosthetic valve endocarditis?

The operative principle is drainage of abscess, removal of debris and valve rep or replacement to reverse haemodynamic abnormality. Any acquired defect like VSD ring abscess, fistula or aneurysm has to be repaired. In children congenital lesion is also rectified.

Availability of intra operative TEE is absolutely essential during surgery. Cardiopulmonary bypass with aortic and bicaval cannulae is instituted. Antegrac and retrograde cardioplegia are administered. Manipulation of heart is kept to a minimum for fear of embolism. For aortic valve endocarditis inspection of anterior mitral leaflet and chordae for drop lesions is a routine procedure. Mitra valve may be repaired and valve perforation could be closed with pericardial patch if infection is under contl-01.

When valve replacement is necessary, the valve is excised and careful check for abscess is done. If present it is drained and debridement done. Abscess that burrows deeper could cause aortoventricular or atrioventricular separation.

Interrupted sutures with pericardial patches are used to treat this and anchor the valve. Larger disruptions are managed with autologus or bovine pericardial patches. The advantage of a bioprosthesis over mechanical valve in preventing re infection has not been proved conclusively. However, for aortic prosthetic valve endocarditits a cryopreserved, free homograft is the best choice. In such cases if there is extensive abscess formation and disruption of aoi-to-ventricular continuity homograft aortic root replacement with re-implantation of coronaries is the preferred technique.

 


Related Discussions:- Describe technique operation prosthetic valve endocarditis

Explain human leucocyte antigen complex, a) Explain the polygonum type of e...

a) Explain the polygonum type of embryo sac. Why is it generally referred to as monosporic ? b) Explain human leucocyte antigen complex? Describe its role in organ transplantati

Bacillary dysentery, Bacillary Dysentery: You have learnt about the di...

Bacillary Dysentery: You have learnt about the diarrhoea in the foregoing sub-section, now let us take for example a child who has loose motion which contains blood and mucus

How are the male gametophytes, How are the male gametophytes and the male g...

How are the male gametophytes and the male gametes formed in angiosperms? In the anthers of every stamen there are pollen sacs. Within the pollen sacs there are microspore moth

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about the food spoilage, Explain about the Food Spoilage? Foods...

Explain about the Food Spoilage? Foods gradually undergo deterioration or spoilage from the time they are harvested, caught, slaughtered or manufactured. Therefore, delay in th

What is the advantage of the double and complete circulation, How many cham...

How many chambers do the bird heart and the mammalian heart have? Concerning temperature maintenance what is the advantage of the double and complete circulation of these animals?

Sieve tubes, What are sieve tubes suited for translocation of food? a.bord...

What are sieve tubes suited for translocation of food? a.bordered pits b.no end walls c.bordered lumen and perforated cross walls D.no protoplasm

How ignorance and poor socioeconomic cause pem, How Ignorance and Poor Soci...

How Ignorance and Poor Socioeconomic cause PEM? Status Improper childcare, either as a result of lack of knowledge or lack of time for mother, could also contribute to the onse

Illustrate steps of polymerase chain reaction , There are three steps of PC...

There are three steps of PCR a) Denaturation.  The reaction combination is heated to 95°C for a short time period (about 15-30 sec) to denature the goal DNA into one strands w

What do you mean by gametogenesis, Q. What is the kind of cell division tha...

Q. What is the kind of cell division that allows sexual reproduction? What is gametogenesis? Meiosis is the kind of cell division that permits sexual reproduction since it redu

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd