Explain the characteristics of a biological community, Biology

Assignment Help:

Which one of the following is one of the characteristics of a biological community?

1.  Stratification

2. Natality

3. Mortality

4. Sex-ratio

 

Stratification

 


Related Discussions:- Explain the characteristics of a biological community

Dextrin, DEXTRIN Intermediate product of hydrolysis of starch. It co...

DEXTRIN Intermediate product of hydrolysis of starch. It consists of maltose & glucose. It is found in yeast & some bacteria.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Coevolution of prey-predators, Predation is a process by which one organism...

Predation is a process by which one organism (predator) eats another organism (prey). If the prey population is abundant, the predator population also becomes abundant. If the pred

Describe in detail about the huntington''s disease, Describe in detail abou...

Describe in detail about the Huntington's disease The brain of a person who has died as a result of Huntington's disease or Alzheimer's disease will look abnormal even to the

Results-pulmonary valve disease, Results :  In critical pulmonary stenosis...

Results :  In critical pulmonary stenosis in infancy, surgical mortality is 6 per cent. For children and adults with isolated pulmonary valve stenosis, the mortality approaches 0

Regents for estimation of reducing sugar by fehling soxhlet, Define Regents...

Define Regents for Estimation of Reducing Sugar by Fehling Soxhlet Method? Fehling A solution - copper sulphate solution Fehling B solution - alkaline tartarate so

Why the effect of genetic drift likely to be the same, Is the effect of gen...

Is the effect of genetic drift likely to be the same in pop 1 and pop 2? How are genetic drift and pop size related? When there is strong selection against the homozygous recessive

Indian tick typhus, Indian tick typhus Indian tick typhus (Mediterrane...

Indian tick typhus Indian tick typhus (Mediterranean spotted fever) is a tick-borne rickettsial infection caused by Rickettsia conori and is characterized by fever and a chara

Feeding mechanisms of animals, Feeding Mechanisms of Animals All anima...

Feeding Mechanisms of Animals All animals have evolved successful methods for extracting their required nutrition from the environment. Thus we find a diversity of feeding mec

What are the symptoms of diverticulosis, Q. What are the symptoms of divert...

Q. What are the symptoms of diverticulosis? Depending on the site of diverticula the symptoms may appear. It occurs most often in sigmoid colon and frequency increases with age

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd