Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Which one of the following is one of the characteristics of a biological community?
1. Stratification
2. Natality
3. Mortality
4. Sex-ratio
Stratification
DEXTRIN Intermediate product of hydrolysis of starch. It consists of maltose & glucose. It is found in yeast & some bacteria.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Predation is a process by which one organism (predator) eats another organism (prey). If the prey population is abundant, the predator population also becomes abundant. If the pred
Describe in detail about the Huntington's disease The brain of a person who has died as a result of Huntington's disease or Alzheimer's disease will look abnormal even to the
Results : In critical pulmonary stenosis in infancy, surgical mortality is 6 per cent. For children and adults with isolated pulmonary valve stenosis, the mortality approaches 0
Define Regents for Estimation of Reducing Sugar by Fehling Soxhlet Method? Fehling A solution - copper sulphate solution Fehling B solution - alkaline tartarate so
Is the effect of genetic drift likely to be the same in pop 1 and pop 2? How are genetic drift and pop size related? When there is strong selection against the homozygous recessive
Indian tick typhus Indian tick typhus (Mediterranean spotted fever) is a tick-borne rickettsial infection caused by Rickettsia conori and is characterized by fever and a chara
Feeding Mechanisms of Animals All animals have evolved successful methods for extracting their required nutrition from the environment. Thus we find a diversity of feeding mec
Q. What are the symptoms of diverticulosis? Depending on the site of diverticula the symptoms may appear. It occurs most often in sigmoid colon and frequency increases with age
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd