Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Skeletal System? Skeletal System: The support framework, or skeleton, in the human body is composed of mostly hard mineral substances. Unlike crustaceans or insec
Explain about the primary protein derivatives? a) Proteins: These are the insoluble products which result from the incipient action of very dilute acids or enzymes. e.g. casein
Q. What are the main characteristics of the age pyramids of developed countries? In the stabilized human population the age pyramid has a narrower base since the reproduction r
explain spermatogenesis
what are the disadvantages of protozoa
What do you mean by Cori Cycling? In this cycle, glucose released by peripheral tissues is metabolized to lactate, which is then resynthesized to glucose in the liver. This pro
functions of iron in the body: Iron is the major component in haemoglobin. It helps to carryout oxygen from lungs to the tissues. About 60 to 70% of Iron in the body i
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are DNA ligases? How do these enzymes participate in the recombinant DNA technology? DNA ligases are enzymes specialized in tying the complementary DNA chains that produce
Q. What is Counsellor? Counsellor is someone who gives advice about the problem. A counselor's role is to help patients help themselves. In our context a counsellor is a comm
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd