Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What do you know about Tricuspid stenosis?
It is rare disease, with rheumatic etiology seen in 90 per cent of cases. In patients with rheumatic mitral stenosis only 3-5 per cent have concomitant tricuspid stenosis. Milder degrees of organic tricuspid valve involvement, up to 15-30 per cent are noted in autopsy series and in echocardiogram. Also tricuspid stenosis progresses much more slowly and develops clinical features on an average a decade later than mitral stenosis. Unusual causes of tricuspid stenosis include carcinoid disease, congenital anomalies, infective endocarditis, Whipple's Disease and right atrial myxoma.
Pathophysiology
Obstruction to the tricuspid valve results in increased right atrial pressures, systemic venous congestion with right heart failure and low cardiac output state.
Clinical Findings
Since tricuspid stenosis, which is most often rheumatic, coexist with mitral stenosis, it is difficult to differentiate symptoms of one disease from other. In general, patient will have complaints of dyspnoea, fatigue and peripheral edema. Jugular venous pressure is characterized by prominent "a" wave and slow "y" descent in sinus rhythm. Absence of ‘y' trough is noted in atrial fibrillation. Diastolic murmur generated across tricuspid valve has a distinct crescendo-decrescendo shape-a finding accentuated in 1o heart block. It is typically located at lower left sternal border and increases with inspiration. Tricuspid opening snap is difficult to appreciate.
Under the limiting oxygen conditions experienced in by vigorous exercise, the configuration of NADH by glycolysis exceeds the ability of the respiratory chain to oxidize it back to
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain Food Sources of lron? lron is found in foods in one of the two forms i.e. haem or non-haem. In the human diet, the primary sources of haem iron are the haemoglobin and
what is a proliferation
Define Polyacrylamide gel electrophoresis (PAGE)? Acrylamide gel has the advantage over starch in that it is easier to prepare and is more inert, the pore size can be varied in
Acute Myocardial Infarction : Patients with acute non-Q myocardial infarction may need urgent intervention as indicated for cases of unstable angina.
Compared to amphibians what is an example of evolutionary novelty present in beings of the class Reptilia against the loss of water through the skin? The reptile skin is kerat
feature
WHAT ARE TYPES OF EGG
What is hemoglobin F? Why does the fetus need a different hemoglobin? Hemoglobin F is the hemoglobin found in the mammalian fetus and hemoglobin A is the normal hemoglobin. Hem
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd