What are taenias, Biology

Assignment Help:

What are taenias? What are the diseases caused by them?

Taenias, also called as tapeworms, are platyhelminth animals (flatworms). The major diseases caused by taenias are taeniasis and cysticercosis.

 


Related Discussions:- What are taenias

Define factorial method to calculate nitrogen requirements, Define Factoria...

Define Factorial method to Calculate Nitrogen Requirements? The nitrogen requirements have been calculated by a factorial method suggested by different expert groups, described

Briefly discuss the salmonella food infection, Briefly discuss the Salmonel...

Briefly discuss the Salmonella food infection. • Salmonella food infection is caused by Salmonella gastroenteritis. Transmitted by faecal contamination of foods. In

Living organisms, List the five kingdoms into which most living organisms c...

List the five kingdoms into which most living organisms can be classified. Most living organisms can be classified as a) Bacteria, b) Protozoa, c) Fungi, d) Plants,

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define x-ray chest and coronary angiography, Q. Define X-Ray Chest and Coro...

Q. Define X-Ray Chest and Coronary Angiography? X-Ray Chest It shows cardiomegaly with left ventricle (LV) and left atrium (LA) enlargement. There may be signs of pulmona

Scintillation counter, carnt understand its principle and mode of working

carnt understand its principle and mode of working

Describe the monomer unit of a protein, Describe the monomer unit of a prot...

Describe the monomer unit of a protein and how monomer units are assembled into peptides.

How many grams of sodium dodecyl sulfate, How many grams of sodium dodecyl ...

How many grams of sodium dodecyl sulfate (mw = 288.37) would you dissolve in 80 mLs of water to make a 20% solution of SDS?

Explain benefits of protein, Explain benefits of Protein Protein: Once ...

Explain benefits of Protein Protein: Once the energy requirements have  been estimated, protein requirements can be addressed. The aim is to achieve nitrogen balance. There are

Liquid manure handling, L iq uid manure handling This involves use of...

L iq uid manure handling This involves use of lot of water to flush the manure in to collection tank. Storage capacity depends on type of farm, irrigation facility, storage t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd