Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Symbiotic interaction - Biological Stress
Presence of symbiotic microorganism can result in differential growth stimulation of those plants which can recognise the beneficial symbionts and utilise their presence in the environment. This interaction is a mutual one. For example in Rhizobium-legume symbiosis the rhizobium causes a drain on the carbon fixed by the plant while the plant gains access to the nitrogen fixed by the bacteria.
Q. What is the relation between the hypophysis and the hypothalamus? The hypothalamus is a part of the brain situated just above the hypophysis and the hypothalamus gets centra
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Determine the Food Sources of Folate? Folate occurs naturally in foods. Although folate is found in a wide variety of foods, it is present in a relatively low density except i
Determine the Physiological Effects phytoestrogens? Little is known about the biologic and physiologic effect of phytoestrogens in humans. Animal studies suggest the following
Q. Why does the ingestion of vegetable fibers improve the bowel habit in people that suffer from hard stools? Some kinds of plant fibers aren't absorbed by the intestine but pl
Pick up just a tiny bit of soil and you will discover a whole new world. Researchers have found that one pinch of soil may contain more than 30,000 protozoa, 50,000 algae, 400,000
Results : In critical pulmonary stenosis in infancy, surgical mortality is 6 per cent. For children and adults with isolated pulmonary valve stenosis, the mortality approaches 0
What are cnidocytes? What is the name of the capsule inside the cnidocyte? What are the biological functions of this structure? Cnidocytes are specialized cells present in coel
Q. Which is the form of protozoan reproduction that generates more variability? Sexual reproduction always generates extra genetic variability than asexual reproduction. That i
Q. Management goals for diverticular disease? The management goals discussed above are basic to prevention of diverticulitis. However, diet therapy during diverticulitis may b
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd