Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cardiomyoplasty
This is a procedure wherein the latissimus dorsi muscle is wrapped around the heart and stimulated to contract synchronously with it. It has been largely given up.
Ventricular Reduction Surgery
A large part of the anterolateral wall is resected to make the heart function more efficiently. Both approaches are too risky in end-stage patients and have not been shown to improve prognosis or symptoms in controlled studies, and for these reasons they have largely been dropped.
Ventricular Assist Devices
Externally powered and implantable ventricular assist devices are used in patients who require ventricular support either to allow the heart to recover or as a bridge to transplantation. However, complications are frequent, including bleeding, thromboembolism, and infection, and the cost is very high. Even though 1-year survival has shown improvement in a recent trial, all the patients died by 26 months.
What is nucleus where it is found? Nucleus : The nucleus is present only in eukaryotic cells. It is the control center and is generally found in the center of the cell. The
PROCEDURES RELATED TO HYGENIC CARE Would you like to remain without a bath on any given day? Do you remain without a bath when you are sick.? No one normally, would like to m
Define Role of Food Industry? Publications of major trade associations; industry standards; structure of the food industry; international food corporations; information on alli
What is Single Ventricle Physiology ? In complete correction of a congenital cardiac condition, it is ideal to have two ventricle correction (Pulmonary and systemic ventricles
What do you understand by Metanephridia? An excretory-osmoregulatory organ comprising a ciliated funnel, nephrostome, connected to tubules that lead to the external nephridiopo
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Check Screws- Check screw access holes for closure. If screw access holes are uncovered, such as the bar-retained dentures, make sure that are free from debris. If screws can b
Ophthalmic Data are limited on the effectiveness of antimicrobial prophylaxis for ophthalmic surgery, but postoperative endophthalmitis can be devastating. Most ophthalmologist
How can we increase of total peripheral resistance? A. A decrease in the diameter of every arteriole. B. An increase of sympathetic discharge to all the smooth muscles
The word 'smog' consists of two words 'smoke' and 'fog'. This name was given because Fog in the atmosphere Condense on the carbon particles of smoke to form smog. There are two typ
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd