Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is sodium-potassium pump ATPase?
A. There is a net flux of sodium from intracellular spaces into luminal spaces through sodium-potassium pump ATPase spanning proteins located in the luminal membranes of epithelial cells in the medullary collecting duct of the kidney.
B. There is a net flux of sodium from intracellular spaces into extracellular spaces through sodium-potassium pump ATPase spanning proteins located in the plasma membranes of toe motor neurons.
C. There is a net flux of sodium from cytosol near troponin molecules into the internal spaces of the sarcoplasmic reticulum through sodium-potassium pump ATPase spanning proteins located in the sarcoplasmic reticulum membranes of diaphragm muscles.
What is the process of Breathing? Oxygen is supplied to the blood, and carbon dioxide is removed from the blood by the process known as breathing. Air is moved into an exchan
Features of the Gastrulation The significant features of the gastrulation are: a) Proteins of many new types that were not present in the egg or blastula begin to be synthe
Pregnancy - Fungal Infections Amphotericin B is the preferred treatment for deep fungal infections during pregnancy. Fluconazole is teratogenic in animals and a same pattern of
Define plasma as Fluid Compartment - extracellular fluid? Plasma is the only major fluid compartment that exists as real collection of fluid all in one location. It differs fro
Q. Conditions Necessary for Outbreak in salmonellosis? The food must contain or become contaminated with the Salmonella bacteria. These bacteria must be there in considerable n
Anti Platelet Drugs In the early years of CABG, patients used to be put on aspirin and persantin (Dipyridamole). Persantin is not routinely prescribed now. Aspirin dose can b
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is Self-jamming Unless all of the mobile client are perfectly synchronized, the arriving transmissions from multiple clients will not be perfectly aligned on chip boundari
Why is the fish circulation classified as a simple and complete circulation? Complete circulation is that in which there is no mixture of venous blood and arterial blood. As ci
(i) Name one fibrous and one globular protein. fibrous globular (ii) Outline the difference in structure between a fibrous and a globular protein. ' shows the ef
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd