What is sodium-potassium pump atpase, Biology

Assignment Help:

What is sodium-potassium pump ATPase?

  A.  There is a net flux of sodium from intracellular spaces into luminal spaces through sodium-potassium pump ATPase spanning proteins located in the luminal membranes of epithelial cells in the medullary collecting duct of the kidney.

  B.  There is a net flux of sodium from intracellular spaces into extracellular spaces through sodium-potassium pump ATPase spanning proteins located in the plasma membranes of toe motor neurons.

  C.  There is a net flux of sodium from cytosol near troponin molecules into the internal spaces of the sarcoplasmic reticulum through sodium-potassium pump ATPase spanning proteins located in the sarcoplasmic reticulum membranes of diaphragm muscles.

 


Related Discussions:- What is sodium-potassium pump atpase

What is the process of breathing, What is the process of Breathing? Oxy...

What is the process of Breathing? Oxygen is supplied to the blood, and carbon dioxide is removed from the blood by the process known as breathing. Air is moved into an exchan

Features of the gastrulation, Features of the Gastrulation The signifi...

Features of the Gastrulation The significant features of the gastrulation are: a) Proteins of many new types that were not present in the egg or blastula begin to be synthe

Pregnancy - fungal infections, Pregnancy - Fungal Infections Amphoteric...

Pregnancy - Fungal Infections Amphotericin B is the preferred treatment for deep fungal infections during pregnancy. Fluconazole is teratogenic in animals and a same pattern of

Define plasma as fluid compartment - extracellular fluid, Define plasma as ...

Define plasma as Fluid Compartment - extracellular fluid? Plasma is the only major fluid compartment that exists as real collection of fluid all in one location. It differs fro

Conditions necessary for outbreak in salmonellosis, Q. Conditions Necessary...

Q. Conditions Necessary for Outbreak in salmonellosis? The food must contain or become contaminated with the Salmonella bacteria. These bacteria must be there in considerable n

Anti platelet drugs-peri operative problems, Anti Platelet Drugs In t...

Anti Platelet Drugs In the early years of CABG, patients used to be put on aspirin and persantin (Dipyridamole). Persantin is not routinely prescribed now. Aspirin dose can b

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is self-jamming, What is Self-jamming Unless all of the mobile cli...

What is Self-jamming Unless all of the mobile client are perfectly synchronized, the arriving transmissions from multiple clients will not be perfectly aligned on chip boundari

Why is the fish circulation classified as simple circulation, Why is the fi...

Why is the fish circulation classified as a simple and complete circulation? Complete circulation is that in which there is no mixture of venous blood and arterial blood. As ci

Explain effect of temperature on the rate of enzyme action, (i) Name one fi...

(i) Name one fibrous and one globular protein. fibrous globular (ii) Outline the difference in structure between a fibrous  and a globular protein. ' shows the ef

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd