Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Young's Trichromatic Theory
According to Young's theory, three types of cones exist, each sensitive to a particular pigment-rythrolabe (red), chlorolabe (green), and cyanolabe (blue). The three classes have a spectral sensitivity that peak at, blue (440-450 nm), green (535-555 nm), and red (570-590 nm). Although the peak wave lengths are different, the three classes of cones have overlapping spectral sensitivity. This occurs because there is a secondary band of absorption that allows sensitivity of all visual pigments to fall off sharply on the wave length side of the peak but less sharply on the short wave length side of the peak.
Neuston - Aquatic Ecosystem These are unattached organisms which live at the air-water interface such as floating plants and several types of animals. Some spend most of their
What are the advancement of cnidaria over protozoa
PREPARATION OF BENZILIC ACID 1. What is rearrangement reaction? The reactions in which the carbon of the molecule is rearranged to give a structural isomer of the original
Lung Biopsy: As with pleural biopsy, lung biopsy may be done by surgical exposure of the lung (open lung biopsy) with or without endoscopy using a needle designed to remove a
What are varices? Why are they more common in the inferior limbs? Varix means abnormal enlargement of veins. Varices happen when excessive pressure against the normal blood fl
Which of the below terms is used to explain the study of factors which influence flow characteristics of blood as it moves through the body? Is it: a) Anginology b) Hemodyna
What are the major morphological differences between monocot plants and dicot plants? The main differentiation criteria among monocots and dicots are: number of cotyledons (see
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Ask question #Minimum 250 words accepted#
Auxins - Plant Growth Substances Julius Sachs (1882) first suggested on the basis of his observations that there are special substances for forming roots and some special subs
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd