Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Results: The risk of isolated aortic valve replacement is 3-4 per cent. The long term survival for 5, 10 and 15years is 75 per cent, 60 per cent and 40 per cent respectively. The postoperative morbidity could be complete heart block, heart failure or neurologic deficit. All prosthetic valves need lifelong anti coagulation and prophylactic antibiotics.
Oxides of nitrogen: These include nitrogen monoxide (NO) and nitrogen dioxide (NO2). NO is a colourless, odourless and inert gas but like CO it can also combine with
What is Quantitative Techniques? Microbial quality of substances like food, milk, air, water, soil etc. can be assessed both qualitatively and quantitatively. Quantitative enum
Q. What are the modes of transmission, main signs and symptoms and treatments of hepatitis C? The Hepatitis C is caused by the RNA virus and transmitted through blood (like hep
P A TTERNS OF CLEAVAGE - Patterns of cleavage depends upon amount of yolk & distribution of yolk. These are following types - 1 . RADIAL CLEAVAGE PATTERN -
Centrioles Centrioles is also called cell centre . Centrosome discovered by Benden . T. Boveri called it centrosome. Centrosome is present in all animal eukaryotic
what is a crabs excretory system?
Which one of the following kinds of animals are triploblastic? 1. Flat worms 2. Sponges 3. Ctenophores 4. Corals Flat worms
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Changes in Body Composition due to Microgravity? Major stress in space is microgravity. Microgravity refers to an environment in which there is very little net gravitat
Germ line gene therapy - This approach either targets to correct the totipotent cells within human conceptus or stimulate the genetic modifications within reproductive cells that
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd