Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Multidrug Resistance
Treatment of MDRTB is based on limited data; patients should be referred, if possible, to clinicians who have experience in treating such cases. MDRTB (resistant at least to isoniazid and rifampin) should be treated with > 4 drugs to which the organism is susceptible. Three drugs are usually given by mouth, the fourth by injection. When MDRTB is likely, or in patients with a history of previous treatment for TB, some clinicians start with combinations of 5, 6 or 7 drugs before laboratory susceptibility data are available.
Typically, empiric therapy for suspected MDRTB includes isoniazid, rifampin, ethambutol, pyrazinamide, an aminoglycoside (streptomycin, kanamycin or amikacin) or capreomycin, a fluoroquinolone (usually levofloxacin, moxifloxacin or gatifloxacin), and either cycloserine, ethion amide or aminosalicylic acid (PAS).
What are the classes into which the phylum Arthropoda is divided? What are the three main ones and some of their representative species? The three major classes of arthropods a
While describing normalising selection it was said that in uniform environments selection limits the variability of populations and evolves a genetic homeostasis. The type of selec
Explain the Systemic Metabolic Responses? Many of the metabolic responses to infection are similar to those following injury. The key changes include: Hyper metabolism: Oxyg
note about water microbiology
Q. What is the neuromuscular synapse? Neuromuscular synapse is the structure through which the neural impulse passes from the axon of a motor neuron to the muscle cell. This st
1. In the town of Jasper, CA, there is currently one full-time family doctor. If the town's population grows at a steady rate of 14% per year, how many family full-time family doc
Q. What is the relation between the concepts of chromosome and chromatin? Are heterochromatin and euchromatin part of chromosomes? Every filament of chromatin is a complete DNA
Define the Indications for Root-End Resection Apicoectomy a) Persistent..... "Exactly the SAME of Curettage except the biopsy. b) When the apical portion of the root canal s
Independent assortment has which of the following effects on the inheritance of alleles? a.Alleles on the same chromosome are not always inherited together. b.Alleles on diff
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd