Explain multidrug resistance, Biology

Assignment Help:

Multidrug Resistance 

Treatment of MDRTB is  based on limited data; patients should be referred, if possible, to clinicians who have experience in treating such cases. MDRTB (resistant at least to isoniazid and rifampin) should be treated with > 4 drugs to which the organism is susceptible. Three drugs are usually given by mouth, the fourth by injection. When MDRTB is likely, or in patients with a history of previous treatment for TB, some clinicians start with combinations of 5, 6 or 7 drugs before laboratory susceptibility data are available.

Typically, empiric therapy for suspected MDRTB includes isoniazid, rifampin, ethambutol, pyrazinamide, an aminoglycoside (streptomycin, kanamycin or amikacin) or capreomycin, a fluoroquinolone (usually levofloxacin, moxifloxacin or gatifloxacin), and either cycloserine, ethion amide or aminosalicylic acid (PAS).

 


Related Discussions:- Explain multidrug resistance

Name the classes into which the phylum arthropoda is divided, What are the ...

What are the classes into which the phylum Arthropoda is divided? What are the three main ones and some of their representative species? The three major classes of arthropods a

Natural selection of heterogeneous environments, While describing normalisi...

While describing normalising selection it was said that in uniform environments selection limits the variability of populations and evolves a genetic homeostasis. The type of selec

Explain the systemic metabolic responses, Explain the Systemic Metabolic Re...

Explain the Systemic Metabolic Responses? Many of the metabolic responses to infection are similar to those following injury. The key changes include: Hyper metabolism: Oxyg

What is the neuromuscular synapse, Q. What is the neuromuscular synapse? ...

Q. What is the neuromuscular synapse? Neuromuscular synapse is the structure through which the neural impulse passes from the axon of a motor neuron to the muscle cell. This st

Determine how many family full-time family doctors, 1.  In the town of Jasp...

1.  In the town of Jasper, CA, there is currently one full-time family doctor. If the town's population grows at a steady rate of 14% per year, how many family full-time family doc

What is concepts of chromosome, Q. What is the relation between the concept...

Q. What is the relation between the concepts of chromosome and chromatin? Are heterochromatin and euchromatin part of chromosomes? Every filament of chromatin is a complete DNA

Define the indications for root-end resection apicoectomy, Define the Indic...

Define the Indications for Root-End Resection Apicoectomy a) Persistent..... "Exactly the SAME of Curettage except the biopsy. b) When the apical portion of the root canal s

What effects on the inheritance of alleles, Independent assortment has whic...

Independent assortment has which of the following effects on the inheritance of alleles? a.Alleles on the same chromosome are not always inherited together. b.Alleles on diff

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd