Records and reports - nursing service administration, Biology

Assignment Help:

RECORDS AND REPORTS:

The principles of administration are described as  'POSDCORB'.  The  'R' stands for recording and reporting. Recording and reporting is related to all other parts of the administrative process. It is a secondary function because it supports planning, organizing, staffing, directing, and controlling and boarding.  It  is  intetnvoven with them all. Every organization keeps some kind of records. Every department in the hospital has its own records. Similarly nursing service section and school of nursing maintain various records. In this practical we shall learn the various records maintained by nurses in the hospital and school of nursing. The examples of few of the nursing records will also be discussed.  


Related Discussions:- Records and reports - nursing service administration

Feed adulterants, Feed adulterants Adulteration of raw material is cre...

Feed adulterants Adulteration of raw material is creating a serious problem for manufacturing the good quality feed as the trading of raw ingredients is totally in unorganized

Stages of aerobic respiration, Stages of Aerobic Respiration: Glycoly...

Stages of Aerobic Respiration: Glycolysis (cytoplasm) Process 2ATP used for Glucose -> Fructose 1,6 bisphosphate Fructose splits into G3P and DHAP. DHAP

Explain horizontal full mucoperiosteal flaps, Explain Horizontal Full Mucop...

Explain Horizontal Full Mucoperiosteal Flaps - Endodontic Surgery      a) Also called:  Envelope flap, b) Only a Horizontal incision, without the vertical releasing incision

Explain assessment of iron status, Explain Assessment of Iron Status? I...

Explain Assessment of Iron Status? In view of widespread iron deficiency, it is important to have reliable and sensitive measures of iron status. Iron status can be assessed by

Explain repressors , Gene repressor proteins which inhibit the trans...

Gene repressor proteins which inhibit the transcription of particular genes in eukaryotes also exist. They may act by binding either to control parts within the promoter region nea

Quick transient responses - behaviour of plants, Quick transient responses ...

Quick transient responses - Behaviour of Plants Such responses are stimulated by factors showing significant variations over relatively small time period e.g., those showing w

Nutrition, what are the examples of parasitic plants

what are the examples of parasitic plants

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What happens at the molecular level, An enzyme isolated from a mutant bacte...

An enzyme isolated from a mutant bacterium grown at 20 degrees celsius works in a test tube at 20 degrees celsius but not at 37 degrees celsius( 37 degrees celsius is the temperatu

Define nutrient needs of a lactating mother, Define nutrient needs of a lac...

Define nutrient needs of a lactating mother? Energy and Protein Needs: Remember that during pregnancy, well-nourished women will have laid down approximately 2-4 kg of fat. Thi

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd