Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Water as a lubricant?
All fluids have lubricating as they can make it easier for the solid materials to slip over one another. Water-based fluids act as lubricants in various parts of the body, most notably within joints where synovial fluid makes movements easier and minimizes wear and tear in cartilage and bone. The lubricant action of saliva and mucus in the mouth and the oesophagus is not so obvious.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Craninal nerves: Cranial nerves take their origin from different areas of brain Some of them are sensory, some are motor and a few are mixed nerves. There are 12 pair
Which of the vertebrate classes (a) are 'warm-blooded', (b) reproduce by laying eggs? (a) Birds and mammals are 'warm-blooded'. (b) Fish, Amphibia, Reptiles
The typological species concept was suggested by Plato more than 2000 years ago. According to this concept, the immense variety in nature can be reduced to a few "types". Individua
What is natural selection? Natural selection is the method by which organisms that have certain favorable traits are better capable to survive and make successfully than organi
what so special for phylum annelida
locomotion in protozoans
Define Goals of National and International Requirement Estimates and RDAs? One of the goals of the RDAs has been reiterated through this unit. They serve as the guidelines for
Artificial Inspiration : a. After artificial expiration, the rescue worker should slowly release the pressure on the back of the victim. b. This will cause the chest cavity t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd