Explain water as a lubricant, Biology

Assignment Help:

Explain Water as a lubricant?

All fluids have lubricating as they can make it easier for the solid materials to slip over one another. Water-based fluids act as lubricants in various parts of the body, most notably within joints where synovial fluid makes movements easier and minimizes wear and tear in cartilage and bone. The lubricant action of saliva and mucus in the mouth and the oesophagus is not so obvious.


Related Discussions:- Explain water as a lubricant

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Energy absorbed by plants, Normal 0 false false false E...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Craninal nerves, Craninal nerves: Cranial nerves take their origin f...

Craninal nerves: Cranial nerves take their origin from different areas of brain  Some of them are sensory, some are motor and a few are mixed nerves. There are 12 pair

Which of the vertebrate classes are warm-blooded, Which of the vertebrate c...

Which of the vertebrate classes (a) are 'warm-blooded', (b) reproduce by laying eggs?   (a) Birds and mammals are 'warm-blooded'. (b) Fish, Amphibia, Reptiles

Typological species concept, The typological species concept was suggested ...

The typological species concept was suggested by Plato more than 2000 years ago. According to this concept, the immense variety in nature can be reduced to a few "types". Individua

What is natural selection, What is natural selection? Natural selection...

What is natural selection? Natural selection is the method by which organisms that have certain favorable traits are better capable to survive and make successfully than organi

Phylum annelida, what so special for phylum annelida

what so special for phylum annelida

Goals of national and international requirement estimates, Define Goals of ...

Define Goals of National and International Requirement Estimates and RDAs? One of the goals of the RDAs has been reiterated through this unit. They serve as the guidelines for

Artificial inspiration, Artificial Inspiration : a. After artificial exp...

Artificial Inspiration : a. After artificial expiration, the rescue worker should slowly release the pressure on the back of the victim. b. This will cause the chest cavity t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd