Parathyroid gland, Biology

Assignment Help:

PARATHYRIOD GLANDS -

  1. They develop from the endoderm of the embryo.
  2. The parathyroid glands consist of four separate glands located on the posterior surface of the lobes of the thyroid gland.
  3. The cells of parathyroid glands are arranged in a compact mass and are of two types: small chief cells or principal cells and large oxyphil cells (or eosinophil cells).
  4. The cells are enclosed by a delicate connective tissue capsule. The chief cells are much more numerous than the oxyphil cells. The latter are absent in the young and appear a little before the age of puberty.

269_parathyroid gland.png


Related Discussions:- Parathyroid gland

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define function of the iron uptake by cells, Define Function of the Iron Up...

Define Function of the Iron Uptake by Cells? Iron has several vital functions in the body. It serves as a carrier of oxygen to the tissues from the lungs by red blood cell haem

Explain procedure for capsule staining in a culture, Explain Procedure for ...

Explain Procedure for Capsule Staining in a Culture? We have learnt that Capsule staining can be undertaken either by negative staining or Anthony method. Now carry out the exe

State the transmission of visual sensation, State the Transmission of Visua...

State the Transmission of Visual Sensation This process takes place in the visual pathway from the retina to the visual cortex. 'The impulse originating in the retina travels a

Altered fat metabolism - metabolic response to injury, Altered Fat Metaboli...

Altered Fat Metabolism - Metabolic Response to Injury? The stored fat deposiis are mobilized and oxidized at a high rate in order to support hyper metabolism and increased gluc

Which is the vertebrate class, Q. Which is the vertebrate class that is con...

Q. Which is the vertebrate class that is considered the first entirely terrestrial? Totally independent from the aquatic habitat, The first entirely terrrestrial vertebrate cla

Explain the nutritional and functional role of sulphur, Minerals :-  Sulfur...

Minerals :-  Sulfur Food Source       Widely distributed  Nutritional Functional role Essential nutrient: A constituent of the essential amino acids methionine and

Etiologial microorganisms, Viridans Streptococci These streptococci, whi...

Viridans Streptococci These streptococci, which cause 30 to 65 per cent of NVE case unrelated to drug abuse, are normal inhabitants of the oropharynx, characteristically produce

Explain the importance for a hypothesis, What's the difference between theo...

What's the difference between theory and hypothesis and explain the importance for a hypothesis to be testable and falsifiable in order for the scientific method to be applied?

ASSINMENT, HISTORY ON CLASSIFICATION IN BIOLOGY

HISTORY ON CLASSIFICATION IN BIOLOGY

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd