Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Concerning their biological function what is the difference between DNA and RNA?
DNA is the source of information for RNA production (transcription) and thus for protein synthesis. DNA is still the basis of heredity due to its replication capability.
The messenger RNA is the template for protein synthesis (translation). In this process tRNA and rRNA also participate since the first carries amino acids for the polypeptide chain formation and the second is a structural constituent of ribosomes (the organelles where proteins are made).
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Renal insufficiency Antimicrobial drugs excreted through the urinary tract may be toxic for patients with renal insufficiency if they are given in usual therapeutic doses, bec
Is cell division happening during the entire cell cycle? What is interphase? Cell division properly happens during the mitotic phase of the cell cycle. During interphase proces
What are the blood types of the ABO blood system? The type A, the type B, the type AB and the type O are the blood types of the ABO blood system..
what stimulate pituitary to release the hormone responsible for paturation name the hormone
Explain what is Prosthetic Valve Endocarditis (PVE) ? Prosthetic valve endocarditis (PVE) is called EARLY when symptoms begin within 60 days of surgery and LATE when the onset
Improper Implant Design Out of the plethora of implant systems available it is the responsibility of the clinician to select the most suitable. In comparison of the straight cy
Q. Why can mitochondria be considered the power plants of the aerobic cells? Mitochondria are the "power plants" of aerobic cells because within them the final stages of the ce
Brain Neurosecretory Cells and their Hormones Kopec was the very first to suggest the role of hormones in controlling metamorphosis. On the base of his experiments on the lar
Define drawbacks of Nutritional status that assessed traditionally? Nutritional status assessed traditionally with the use of anthropometric, biochemical clinical and dietary a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd