Palynofossils (microfossils), Biology

Assignment Help:

Palynofossils (Microfossils) -

Fossils of planktons, diatoms, unicellular algae (diatoms) and shelled protozoans. (Heliozoans, Radiolarian and Foraminifera). Its finding in soil sample helps in oil exploration.

The earth of that time (precambrian era) is called "diatomaceous earth".


Related Discussions:- Palynofossils (microfossils)

Regulation of kidney function, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

How hermaphrodite species present cross-fecundation, Is it possible for a h...

Is it possible for a hermaphrodite species to present cross-fecundation? There are hermaphrodite species of animals and plants that present cross-fecundation mainly because of

The permissible use of the technique amniocentesis, The permissible use of ...

The permissible use of the technique amniocentesis is for: 1. detecting sex of the unborn foetus 2. artificial insemination 3. transfer of embryo into the uterus of the su

Determine the interactions among the splicing machinery, Which of the follo...

Which of the following mediates the interactions among the splicing machinery and the mRNA transcript? A. Alpha helical structures within the RNA binding domain of the splicing

Gram - negative bacteria, Organisms of the so-called HACEK group, (Haemophi...

Organisms of the so-called HACEK group, (Haemophilus, Actinobacillus actinomycetemcomitans, Cardiobacterium hominis, Eikenella species, Kingella kingae) which are part of the upper

Explain anaplerotic reactions, Anaplerotic Reactions Anaplerotic  reac...

Anaplerotic Reactions Anaplerotic  reactions are  reactions  that  replenish the  intermediates of  citric acid cycle. The  special  enzymatic mechanisms  by  which  the  pool

Strategie of the anti-retroviral drug used in aids treatment, Q. What are s...

Q. What are some strategies of the anti-retroviral drugs used in the AIDS treatment? The Anti-retroviral drugs used in AIDS treatment try to approach any of the several steps o

Explain about the freeze drying Method, Explain about the freeze drying Met...

Explain about the freeze drying Method? The Techniques of freeze-drying have been developed over the past half-century for the purpose of preserving certain biological material

Discuss the biological importance of imidazole, Discuss the biological impo...

Discuss the biological importance of Imidazole. Bring in examples of biomolecules that contain this group. Please be as thorough as possible.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd