Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Palynofossils (Microfossils) -
Fossils of planktons, diatoms, unicellular algae (diatoms) and shelled protozoans. (Heliozoans, Radiolarian and Foraminifera). Its finding in soil sample helps in oil exploration.
The earth of that time (precambrian era) is called "diatomaceous earth".
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Is it possible for a hermaphrodite species to present cross-fecundation? There are hermaphrodite species of animals and plants that present cross-fecundation mainly because of
The permissible use of the technique amniocentesis is for: 1. detecting sex of the unborn foetus 2. artificial insemination 3. transfer of embryo into the uterus of the su
Which of the following mediates the interactions among the splicing machinery and the mRNA transcript? A. Alpha helical structures within the RNA binding domain of the splicing
Organisms of the so-called HACEK group, (Haemophilus, Actinobacillus actinomycetemcomitans, Cardiobacterium hominis, Eikenella species, Kingella kingae) which are part of the upper
Anaplerotic Reactions Anaplerotic reactions are reactions that replenish the intermediates of citric acid cycle. The special enzymatic mechanisms by which the pool
Q. What are some strategies of the anti-retroviral drugs used in the AIDS treatment? The Anti-retroviral drugs used in AIDS treatment try to approach any of the several steps o
Explain about the freeze drying Method? The Techniques of freeze-drying have been developed over the past half-century for the purpose of preserving certain biological material
Discuss the biological importance of Imidazole. Bring in examples of biomolecules that contain this group. Please be as thorough as possible.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd