Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The standard free energy change and standard activation energy for four biochemical reactions are listed in the table below:
A few interpretations are given below. Between these, the most appropriate interpretation is:
a. P, Q, R and S represent the same reaction carried out in the presence of enzyme, high temperature, absence of enzyme and low temperature, respectively.
b. Q and S represent the similar reaction carried out at high and low temperatures, respectively.
c. R and S represent the similar reaction carried out in the presence and absence of catalyst, respectively.
d. P and R show the same reaction carried out in the absence and presence of enzyme, respectively.
1. Explain how bats determine the distance (range) of their target using echolocation. Be sure to describe the properties of their call that make it possible (use a sketch), and ho
Define Nutritional Requirement and Dietary Modifications in the Diet of the Elderlu? The nutritional status influences the age-related rate of functional decline in many organ
M a r e k ' s disease (MD) It is a lymphopoliferative disease of domestic chicken caused by a herpes virus. Of the known 3 serotypes of MDV, Serotype I includes all the o
Digestion of proteins Digestion of proteins is initiated in the stomach by pepsin. Pepsin acts upon food proteins and converts them to proteoses and peptones whic
What are autotrophic beings? What are heterotrophic beings? The Autotrophic beings are those that can produce their own food that is that make organic material from inorganic c
Are protozoans under the Kingdom Animalia?
Direct demonstration of the causative agent by electron microscopy (EM): Where facilities for electron microscopy are available and a viral disease is suspected, presence o
classification of excretory organs in helminthes, nermatodes, annelids, molluscs, arthropods and echinodems
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain glycolysis? Name the two monosaccharides which readily enter the glycolytic pathway. Illustrate a diagrammatic sketch of the microscopic view of a mammalian sperm a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd