Multidisciplinary approach to solving nutrition problems, Biology

Assignment Help:

Define Multidisciplinary Approach to Solving Nutrition Problems?

You must have realized by now that solving public nutrition problems represents a multidisciplinary challenge of large magnitude and therefore requires a multidisciplinary approach to find a solution. Science and technology have been able to make meaningful contributions to socioeconomic development only when they have acted in an interdisciplinary manner to solve the problems. Hence, there is a need to recognize the value of such an approach and give special attention to organizing activities that would involve teams of scientists (both social and natural), technologists, policy-makers and planners (including development economists) and the implementers of programmes to collectively look into the major problems of mankind and find solutions for them through co-operative efforts.

The concerned disciplines should stimulate each other consciously and create a comprehensive and dynamic system capable of multidisciplinary action that could increase the pace of progress towards establishment of a more equitable and just social order in this world. This effort could convert the vicious cycle in which we are caught at present into dynamic development cycles. There are many kinds of disciplines which have an impact on nutrition. However, in this unit we would limit ourselves to the discipline of agriculture and science and technology as used to improve agriculture. In the coming section, we will study, how agriculture and horticulture production, storage, distribution of food products and science and technology influence food consumption and nutritional status of the population? And how can all these fields interact with each other and with other areas in order to benefit society?

 


Related Discussions:- Multidisciplinary approach to solving nutrition problems

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Why that property of water is important to life, Choose one property of wat...

Choose one property of water and explain why that property is important to life.

Cartilage occur in a joint and what it its function, Where does cartilage o...

Where does cartilage occur in a joint and what it its function? Cartilage might be found covering the surface of bones where they meet in a movable joint. Cartilage decreases f

Class of coclentrata, ????? # 100 ??????????? #Minimum ?????? ?????

????? # 100 ??????????? #Minimum ?????? ?????

Interaction of vitamin c with ascorbic acid and leucine, Define Interaction...

Define Interaction of vitamin c with Ascorbic acid and Leucine? Ascorbic acid : The biologically active form, ascorbate, is a cofactor or co-  substrate for eight isolated enz

Write the blood sugar in normal range and range in diabetes, Q. Write the b...

Q. Write the blood sugar in normal range and range in diabetes? Normal           Diabetes mellitus >126 mg / dl >200 mg / dl

What is the disease caused by vitamin d deficiency, Q. What is the disease ...

Q. What is the disease caused by vitamin D deficiency? Which tissue does it affect? The lack of vitamin D causes the disease known as rickets (rachitis), characterized by bone

Determine the prevention of flap necrosis, Prevention of flap necrosis ...

Prevention of flap necrosis Flap necrosis can be prevented if the surgeon attends to four basic principles. 1. First, the apex of a flap should never be wider than the base,

Define briefly about the pyridoxine vitamin, Define Briefly about the Pyrid...

Define Briefly about the Pyridoxine vitamin B 6 ? Pyridoxine or vitamin B 6 is one of the B complex vitamins which prevents and cures dermatitis in rats fed on vitamin B 6 de

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd