What is determined by tube feet, Biology

Assignment Help:

What is determined by tube feet?

Hollow and fluid-filled tubes which are part of the water vascular system in Echinoderms. Muscles associated with tube feet allow them to be hydraulically controlled and function in locomotion, attachment, food gathering, and gas exchange.

 


Related Discussions:- What is determined by tube feet

Methods of filter feeding, Methods of Filter Feeding More elaborate me...

Methods of Filter Feeding More elaborate methods of filter feeding are seen in tube dwelling polychaetes which use tentacles to entangle the food particles. Figure shows some

Explain the radiographic examination of prothesis, Radiographic Examination...

Radiographic Examination Radiographs are an important tool to evaluate the bone levels, health and implant integrity.  Annual radiographs following treatment are recommended in

Herbage area or vegetation cover, Herbage area or vegetation cover Her...

Herbage area or vegetation cover Herbage area or vegetation cover is an important aspect of vegetation study in understanding the nature of a community particularly in evaluat

What is the typical vegetation of the grasslands, What is the typical veget...

What is the typical vegetation of the grasslands? The Grasslands are mainly formed of herbaceous (nonwoody) vegetation: grass, small trees and bushes.

How to calculate fractional shbrtening, Q. How to calculate Fractional Shbr...

Q. How to calculate Fractional Shbrtening? With the cursor- beam cutting the left ventricle just beyond the tips of mitral valve in an adequate parasternal long axis view,

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the kind of digestive system of echinoderms, Q What is the kind of ...

Q What is the kind of digestive system of echinoderms? Echinoderms present a complete digestive system with anus and mouth. Q. Do sea urchins have teeth? Sea urchins ha

Etiological factors contributing to lactose intolerance, Q. Etiological fac...

Q. Etiological factors contributing to lactose intolerance? The etiological factors contributing to lactose intolerance include: • Genetic factor • Reduction in jejunal

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd