Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Measures of Evenness
The maximum Shannon-Wiener index for a given number of species can be calculated as:
The minimum Shannon-Wiener index for a given data set can be calculated as:
where
S is the number of categories or species
N is the total number of observations.
The evenness of the sample can be calculated by the following two equations:
According to this index, Area A with four species with four individuals each will have greater species diversity than area B also with four species but with one having 13 individuals while the other three have only one individual each.
Q. What are the phospholipids? Phospholipids are molecules made of glycerol bound to one phosphate group and to two long molecules of fatty acids. hence, phospholipids are amph
What are the chemical substances that compose the plasma membrane? Ans) The major constituents of the plasma membrane are phospholipids, proteins and carbohydrates. The phosphol
What are the differences between blood retinal barrier and blood aqueous barrier? Blood Retinal Barrier: Blood retinal barrier is present in retina. In retina there are t
Q. What is Atherosclerosis? Atherosclerosis is an arterial lesion characterized by patchy thickening of the intima (innermost coal of artery) comprising of fat and layers of co
Coelenterata – General characters and classification.
Immunogenicity Based on immunogenicity studies and experience with other vaccines, the new meningococcal conjugate vaccine (Menactra) should be highly effective in preventing m
State about the Halsted Reitan battery The Halsted Reitan battery, as the procedure came to be known over the years, also has a history. It has been described as a fixed batter
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the mitochondria? What is the fundamental morphology of these organelles and in which cells can they be found? Mitochondria are the organelles in which the most sig
What is the function of keratin in the epidermis? The epidermis is the outer layer of the skin made of epithelial tissue. In the epidermis there are keratin-secreting cells (ke
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd