Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. List some points to keep in mind while counselling?
1. Judgment
Do not be judgemental. Be a patient listener. Assess and make decision. 2. Patience and Acceptance
Have patience and accept patient as an individual. . 3. Experience
Grow with experience to handle and guide people in distress. 4. Body Language
Body language has to be congruent with what he is saying so as to avoid any confusion or misinterpretation. 5. Genuineness and Warmth
Have a genuine interest in other people and warmth in behaviour.
6. Practice, Practice, Practice
Counselling requires a lot of training and practice.
Aplastic Anaemia Aplastic anaemia is a condition in which production of red cells in the bone marrow is reduced. It involves failure to produce adequate red cells, white cell
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Which of the following statement is false regarding the method of recombination or crossing-over? A. Crossing-over takes place during prophase I of meiosis B. Recombination
Observing root hairs Study the root hairs with a hand lens and view how they are constructed.
#what characteristics of green algae that led to biologists considered it as a plant?
Ecological Pyramids - Ecosystem The ancient Egyptians constructed elaborate tombs called pyramids. The base of the pyramid is broad and it supports the upper levels of the str
Name the location and function of Meibomian glands in the human eye. a) What is cryopreservation? Give its single use. b) Commercial importance of cryopreservation is relate
Proteins of Plant Origin - Cereal Proteins Cereal Proteins: Cereal grains, properly ripened and dried for optimum storage stability, have protein content ranging from 6-20%.
what are the functions of cytoplasm ?
Define Dietary Goals in Parkinson's Disease? The main goals include: - Maintain desirable weight - Promote absorption of anti- Parkinson's drug levodopa - Lessen swall
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd