Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. How do schistosomes differentiate regarding sex separation?
The Schistosomes are dioecious that is the species has separated sexes, female and male individuals.
how many atoms are H2SO4 compound
prove oxygen is produced during photosynthesis in the presence of light
What is Cancer? Besides AIDS, Cancer is another deadly human disease of our times about which people are panicky all over the world. It is estimated that one in every three per
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain sol -gel transformation During sol -gel transformation, a three dimensional network is formed by the interlocking of dispersed particles. The liquid phase is entrapped
Q. What are immunoglobulins? Immunoglobulin is the alternate name given to antibody and Immunoglobulins are complex proteins containing a variable portion and an invariable por
ORIGIN (1) From Pro plastid (2) Division (3) Endosymbiotic origin from a cyanobacterium
Define Precautions for Preparation of Phosphate Buffers? 1. Glass electrodes should always be dried before and after measuring pH with a tissue paper. 2. The pipettes should
Q. Factors Affecting Water requirements of microorganisms? Factors that may affect aw requirements of microorganisms include: 1. Kind of solute employed to reduce the aw: F
What is the difference between the alpha helix and the beta-sheet protein conformations? Ans) Alpha helix and beta-sheet conformations are the two major types of secondary struc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd