How do schistosomes differentiate regarding sex separation, Biology

Assignment Help:

Q. How do schistosomes differentiate regarding sex separation?

The Schistosomes are dioecious that is the species has separated sexes, female and male individuals.


Related Discussions:- How do schistosomes differentiate regarding sex separation

Study giude, how many atoms are H2SO4 compound

how many atoms are H2SO4 compound

Nutrition, prove oxygen is produced during photosynthesis in the presence o...

prove oxygen is produced during photosynthesis in the presence of light

Cancer, What is Cancer? Besides AIDS, Cancer is another deadly human di...

What is Cancer? Besides AIDS, Cancer is another deadly human disease of our times about which people are panicky all over the world. It is estimated that one in every three per

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain sol -gel transformation, Explain sol -gel transformation During...

Explain sol -gel transformation During sol -gel transformation, a three dimensional network is formed by the interlocking of dispersed particles. The liquid phase is entrapped

What are immunoglobulins, Q. What are immunoglobulins? Immunoglobulin i...

Q. What are immunoglobulins? Immunoglobulin is the alternate name given to antibody and Immunoglobulins are complex proteins containing a variable portion and an invariable por

Origin of plastid, ORIGIN (1) From Pro plastid (2) Division (3) E...

ORIGIN (1) From Pro plastid (2) Division (3) Endosymbiotic origin from a cyanobacterium

Define precautions for preparation of phosphate buffers, Define Precautions...

Define Precautions for Preparation of Phosphate Buffers? 1. Glass electrodes should always be dried before and after measuring pH with a tissue paper. 2. The pipettes should

Factors affecting water requirements of microorganisms, Q. Factors Affectin...

Q. Factors Affecting Water requirements of microorganisms? Factors that may affect aw requirements of microorganisms include: 1. Kind of solute employed to reduce the aw: F

Alpha helix and the beta-sheet protein, What is the difference between the ...

What is the difference between the alpha helix and the beta-sheet protein conformations? Ans) Alpha helix and beta-sheet conformations are the two major types of secondary struc

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd